TABLE 2.

Primers used in this study

Gene and primerSequence (5′ → 3′)aReference(s)
16S rRNA
    16F27AGAGTTTGATCMTGGCTCAG23
    16R1492TACGGYTACCTTGTTACGACTT
ITS1
    sp1ACCTCCTTTCTAAGGAGCACC32
    sp2GATGCTCGCAACCACTATCCA
gyrB
    gyrBAGAGTTGGTGCGGCGTAAGAGC10
    gyrBECGGCCATCCARCACGATCTTG
hsp65
    TB11ACCAACGATGGTGTGTCCAT38
    TB12CTTGTCGAACCGCATACCCT
recA
    recF3GGCAARGGYTCGGTSATGC4
    recF4TCGACCAACTACTTCTARCG
    recR2TTGATCTTCTTCTCGATCTC
rpoB
    MycoFGGCAAGGTCACCCCGAAGGG1
    MycoRAGCGGCTGCTGGGTGATCATC
    MycoseqFGAAGGGTGAGACCGAGCTGAC
    MycoseqRGCTGGGTGATCATCGAGTACGG
sodA
    Z205FACGTTCACCACAGCAAGCACCA11, 48
    Z212RTCGGCCCAGTTCACGACGTT
    GSOD2RTCGGCCAGTTCACGACGTTCCA
  • a M = A or C; N = A, C, G, or T; R = A or G; S = C or G; Y = C or T.