TABLE 3.

Group-specific primers based on 16S rDNA sequences

Target bacteriaPrimeraSequence (5′ to 3′)Product size (bp)Annealing temp (°C)
Bacteroides fragilis groupg-Bfra-FATAGCCTTTCGAAAGRAAGAT50150
g-Bfra-RCCAGTATCAACTGCAATTTTA
Prevotellag-Prevo-FCACRGTAAACGATGGATGCC527-52955
g-Prevo-RGGTCGGGTTGCAGACC
Bifidobacteriumg-Bifid-FCTCCTGGAAACGGGTGG549-56355
g-Bifid-RGGTGTTCTTCCCGATATCTACA
Clostridium coccoides groupg-Ccoc-FAAATGACGGTACCTGACTAA438-44150
g-Ccoc-RCTTTGAGTTTCATTCTTGCGAA
  • a The standardized primer names are as follows: g-Bfra-F, S-G-Bfra-0148-a-S-21; g-Bfra-R, S-G-Bfra-0626-a-A-21; g-Prevo-F, S-G-Prevo-0803-a-S-20; g-Prevo-R, S-G-Prevo-1311-a-A-16; g-Bifid-F, S-G-Bifid-0153-a-S-17; g-Bifid-R, S-G-Bifid-0699-a-A-22; g-Ccoc-F, S-G-Ccoc-0477-a-S-20; and g-Ccoc-R, S-G-Ccoc-0895-a-A-22 (1).