TABLE 1.

Primers used for gene expression analysis

GenePrimer sequence
Forward (5′ to 3′)Reverse (5′ to 3′)
rpoS GCAAGATGAAGACATGCGTGCTTCAACCTGAATCTGGCG
groEL CGCAAGCTATCGTAAATGTGGGGAGTTCGCAGAGATGGTGCCTAC
relA ACTGGGCGACGTGATGTGCCAAAGGCCAGCCAATGT
smcR TTCTTGTGGCGACCGTCTTCAACCTTCACCACGCTCAATGGCT
trkA GTCAGGTCGCCTTTACTCTTTCGTCTTCGTTGGTGAG
vvpE ACTGTTTGCCGTCCAATACCGGGTGAAGCGGCAGAGT
viuB GGTTGGGCACTAAAGGCAGATTCGCTTTCTCCGGGGCGG
hfq AGGGGCAATCTCTACAAGTCTACTGTGGTTCCTGCT