TABLE 1.

Oligonucleotides, primers, and probes

AssayPrimer and probe sequences (5′→3′)Size (bp)Reference or source
BthetaForward, CGTTCCATTAGGCAGTTGGT; reverse, ACACGGTCCAAACTCCTACG; probe, FAM-CTGAGAGGAAGGTCCCCCACATTGGA-TAMRA110Blackwood and Noblea
GB342Forward, GGGGTTCTGAGAGGAAGGT; reverse, AGTAGCGTGAAGGATGACGG; probe, FAM-CAATATTCCTCACTGCTGCCTCCCGTA-TAMRA12928
Entero1Forward, AGAAATTCCAAACGAACTTG; reverse, AATGATGGAGGTAGAGCACTGA; probe, FAM-TGGTTCTCTCCGAAATAGCTTTAGGGCTA-TAMRA9221
CowM2CowM2F, CGGCCAAATACTCCTGATCGT; CowM2R, GCTTGTTGCGTTCCTTGAGATAAT; probe, FAM-AGGCACCTATGTCCTTTACCTCATCAACTACAGACA-TAMRA92This study
CowM3CowM3F, CCTCTAATGGAAAATGGATGGTATCT; CowM3R, CCATACTTCGCCTGCTAATACCTT; probe, FAM-TTATGCATTGAGCATCGAGGCC-TAMRA122This study
Cow IACFrag1, CGGCCAAATACTCCTGATCGTCCTCTAATGGAAAATGGATGGTATCTATTACTCATAGGCACTAGGAACAGGCGGCGACGAAACTACAGACAAAATTATCTCAAGAACG; Frag2, CCATACTTCGCCTGCTAATACCTTAAGGACATAGGCTTGTTGCGTTCCTTGAGATAATTTTGTCTGTAGTTTCGTCGCCGCCTGTTCCTAGTGCCTATGAGTAATAGATA; probe, VIC-TAGGAACAGGCGGCGACGA-TAMRAb15242; this study
  • a Presented at the 105th General Meeting of the American Society for Microbiology.

  • b The TaqMan probe was modified from the previously reported UT probe (42).