TABLE 1.

List of oligonucleotidesa

Primer nameSequence (5′ to 3′)Purpose
Smu-HtrA-F1gactagcattatttggaattttctcatcggAmplification of htrA and construction of pIB101
Smu-HtrA-R1gaggtgagatatgaagacaacttcgttgac
Smu-HtrA-F2aataacgaaggtcaaatcagaaVerification of the htrA gene deletion
Smu-HtrA-R2atatctttagtattaagatatt
Smu-ClpP-F1gttccaggtcttggggatgcaggcgatcgcttgAmplification of clpP and construction of pIB143
Smu-ClpP-R1ggtggtttatgcggtgccagcggtaaacccg
Smu-ClpP-F2ctgaagatattgaccaacgtcaVerification of the clpP gene deletion
Smu-ClpP-R2cgtatcaatataggatggaaga
loxP-Km-FCGATAACTTCGTATAATGTATGCTATAGCAAGTTATgaggatgaagaggatgaggaggcagAmplification of Kmr marker with flanking native loxP sequences
loxP-Km-RCGATAACTTTGTATAGCATACATTATACGAAGTTATgctttttagacatctaaatctagg
lox71-Km-FCGTACCGTTCGTATAGCATACATTATACGAAGTTATgaggatgaagaggatgaggaggcagAmplification of Kmr marker with flanking mutant loxP sequences
lox66-Km-RCGTACCGTTCGTATAATGTATGCTATACGAAGTTATgctttttagacatctaaatctagg
lox71-Sp-FCGTACCGTTCGTATAGCATACATTATACGAAGTTATctagataaaaaatttagaagcccaatgAmplification of Spr marker with flanking mutant loxP sequences
lox66-Sp-RCGTACCGTTCGTATAATGTATGCTATACGAAGTTATctgttatttaaatagtttatagttaaatttac
  • a loxP sites are presented in boldface, and mutations created to generate lox66 and lox71 sites are underlined. DNA sequences homologous to template DNA are presented in lowercase letters.