TABLE 4

Sequences of primers for PCR

PrimerSequence (5′→3′)Tm (°C)Product size (kb)Reference
27FAGAGTTTGATCCTGGCTCAG581.544
1492RGGCTACCTTGTTACGACTT
Det-hyp-2mob-FGTGCCTGAATGGTTAGATATAGC680.86This study
Det-hyp-2mob-RTTATCCTTTTAAAATAGGGGTCACTTTATC
Lhr2-FTACAAGATTGCCCTGGAAGT600.2014
Lhr2-RCTTGATCGAATCCTGGTTGG
HR-F1TTAGGTACCGCTGTCCATTGCCTGA621.87
HS-R1AGACCAATCAGGAAATGCTCTGGACC
HR-F2.2GAGGTACCTGTCTTGCCTGACAACGTTG642.87
HR-R2TATCTAGAATGTCATTTCTATGGAGGCATGAATCG
HS-F1GCAATCCTTTGCCGCAGCTATT642.87
HR-R3GTCAAGCTTCTAGGGCTCGTAGTTCG