TABLE 1

Primer sequences used for PCR amplification for multiplexed sequencing

Target genePrimer nameSequenceaThermal cycling conditionsbReference
Bacterial 16S rRNA343fNNNNNNNTATACGGRAGGCAGCAG94°C for 30 s, 50°C for 30 s, 72°C for 30 s (25 + 7 cycles)64
802rTACNVGGGTWTCTAATCC
Fungal ITS1ITS-1NNNNNNNAATCCGTAGGTGAACCTGCGG94°C for 30 s, 56°C for 30 s, 72°C for 60 s (28 + 7 cycles)84
ITS-2GCTGCGTTCTTCATCGATGC
AOB amoAamoA-1fNNNNNNNAAGGGGTTTCTACTGGTGGT94°C for 30 s, 54°C for 30 s, 72°C for 60 s (25 + 5 cycles)60
amoA-2rCCCCTCKGSAAAGCCTTCTTC
AOA amoAamoA-310fNNNNNNNGGTGGATACCBTCWGCAATG94°C for 30 s, 54°C for 30 s, 72°C for 60 s (25 + 5 cycles)85
amoA-529rGCAACMGGACTATTGTAGAA
  • a The sample index (consecutive Ns) and linker (bold letters) prior to the extension bases in the forward primer are indicated.

  • b The first number in parentheses indicates the number of cycles performed in the fist PCR where the unindexed primers were used, while the second number indicates the additional cycles performed in the sample indexing PCR step.