TABLE 3

Oligonucleotide primers used for plasmid construction

NameSequence
SUL1 ko FATGTCACGTAAGAGCTCGACTGAATATGTGCATAATCAGGAGGATGCTGA TGTTTAGCTTGCCTCGTCC
SUL1 ko RCTAAACGTCCCATTTAGAAAAATCGGGTATATCGATATGAAAAAACGGTA GAATTCGAGCTCGTTTAAAC
SUL2 ko FATGTCCAGGGAAGGTTATCCAAACTTTGAAGAGGTAGAAATTCCTGACTT AACTGTGGGAATACTCAGGT
SUL2 ko RCTAGATATCCCATTTAGCAAAATCTGGGATATCGATATGGAAGAAAGGTAATATCGACTACGTCGTTAAGG
MET5 ko FATGACTGCTTCTGACCTCTTGACGCTCCCACAATTGTTGGCGCAATATTCGCTTCGTACGCTGCAGGTC
MET5 ko RTTAATAGGCATCTTCAGACACATCTTCATGGAAGTATTTACCCTCGGTGGCCAATACGCAAACCGCCTCT
CYS3 ko FTAGACATTTGCACCTTATACATATACACACAAGACAAAACCAAAAAAAAT GCTTCGTACGCTGCAGGTC
CYS3 ko RTTATCGTACTTAAAAAGGTCCGGTCGAAGGCAGAGACGTGGCACTGGCGACCAATACGCAAACCGCCTCT
MET15 ko FATGCCATCTCATTTCGATACTGTTCAACTACACGCCGGCCAAGAGAACCC GCTTCGTACGCTGCAGGTC
MET15 ko RTCATGGTTTTTGGCCAGCGAAAACAGTTTCAAAAGATTGCTGGAAGTCTG CCAATACGCAAACCGCCTCT
MET15 ORF FATCTAAGTTTTAATTACAAAATGCCATCTCATTTCGATACTG
MET15 ORF RCTAATTACATGAGAGCTCGGTCATGGTTTTTGGCCAGCGAA
MET15 his FCGACGACGACAAGGCCATGGCTGATCCATCTCATTTCGATACTGTTCAACT
MET15 his RCAGTGGTGGTGGTGGTGGTGCTCGATCATGGTTTTTGGCCAGCGAA
SUL1 in FACCGCACATATAGGGAATCTG
SUL1 in RATAGATTGGGGCACGAGTAC
SUL1 out FTGCACATGGATCTTGTACTG
SUL1 out RAAATAGGCTCAAGCTCAAGTTAAC
SUL2 out FGATATGTCCAGGGAAGGTTATC
SUL2 out RGGCACCATCCTACCTATTATTT
SUL2 in FGATATGTCCAGGGAAGGTTATC
SUL2 in RCCAGTTGATGATGGGAAAAAC
SOA1 ko FATGTCCGTACAAAAAGAAGAATACGATATTGTAGAAAAGGCCCAATTATCGCTTCGTACGCTGCAGGTC
SOA1 ko RCTAGTGAATAAACCTATAATCAAGACGCTTCATTCCCTTATCTTTAGTTGCCAATACGCAAACCGCCTCT
SOA1 in FATTGTAGAAAAGGCCCAATTAT
SOA1 in RCAAGTATAGAATATTGTCCGGG
SOA1 out FATTGTAGAAAAGGCCCAATTAT
SOA1 out RGAATAAACCTATAATCAAGACGC
MET5 in FATGACTGCTTCTGACCTCTT
MET5 in RTCTCTTCGTTAGCAATCTCC
MET5 out FAAAGTAACAGTAGGGAACGG
MET5 out RGATTTTATTCTTCACCTCGTT
CYS3 in FCCACTCCGCTACAAAGTAC
CYS3 in RCAGAGATTCTAACCAAGTCGTC
CYS3 out FCGTGCCAGATTGAATTTTGAA
CYS3 out RCATCTAACACGATTGATTGAGC
MET15 in FGATCCAGAGCTGTACCAATTTAC
MET15 in RACAAATCTAGCCTCGATACC
MET15 out FGAACACGCTCGATGAAAAAA
MET15 out RCTTGTGAGAGAAAGTAGGTTTATAC
TEF1 FCCAAGCTTGATCCCCCACACACCATA
TEF1 RCGGGATCCTTTGTAATTAAAACTTAGATTAGATTGCT
CYC1 FCTTGAGCTCTCATGTAATTAGTTATGTCACGCT
CYC1 RCCGGAATTCGCAAATTAAAGCCTTCGAGC
SUL1 RT FCACTGGGTTGGGTATACTGC
SUL1 RT RATGAGAGCCGGAATTTGACC
SUL2 RT FCACGGTGAAAGGAGCATGTA
SUL2 RT RCCAGTTGATGATGGGAAAAAC
ACT1 RT FATGGTCGGTATGGGTCAAAA
ACT1 RT RTCCATATCGTCCCAGTTGGT
RDL1 ko FAATTCTTTCTCGTTTATTTTCAGGGTTTGTGACTAAGAAACGATATTAAAGCTTCGTACGCTGCAGGTC
RDL1 ko RGTTACTAGCTTACGAAAATACACAGGGTACATACCTAGAGTATACAAGGCCAATACGCAAACCGCCTCT
RDL1 in FCCGTGATGAATGCTTGGAAT
RDL1 in RTATCACCCCCATGAGAAACC
RDL1 out FGAGAGTGGAGGCTTAATCAA
RDL1 out RAACGGTGTGACATAAATGGC
RDL1 self FTATGACCATGATTACGCCATTTTATTGGCGCATAGACAAG
RDL1 self RGTCGACCTGCAGGCATGCATGGGGTGTTCGACTAGGTT
RDL1 his FCGACGACGACAAGGCCATGGCTGATTGGAAGGCCGTGATGAATGC
RDL1 his RCAGTGGTGGTGGTGGTGGTGCTCGATTATAAGTCAAGTTTATCACCCCCATGAG
RDL2 ko FGCGATAACTCTCAACAAATGGAAGCGAGACAGAAGAAAAAGACCAACGCTTCGTACGCTGCAGGTC
RDL2 ko RAAAGGTTGTCTATATACAGGATATATCGATTATACTTGTTTCTTTTTGGC CCAATACGCAAACCGCCTCT
RDL2 in FCAAGATCGCCTACATTGGT
RDL2 in RGATACCAGTGTTTTCGTACCC
RDL2 out FTGGAAGCGAGACAGAAGAAA
RDL2 out RCACAAGGAGAAAATCGAATGAATC
RDL2 self FTATGACCATGATTACGCCAGAACCATCTGAGTACTCGATT
RDL2 self RGTCGACCTGCAGGCATGCAGAAAAAGTCTGAGAAACGTAAAGT
RDL2 his FCGACGACGACAAGGCCATGGCTGATTTCAAGCATAGTACAGGTATTCT
RDL2 his RCAGTGGTGGTGGTGGTGGTGCTCGATTATTTTTTGGGCTTAACGTCAG
TUM1 ko FATGCCATTATTTGATCTTATTTCTCCAAAAGCGTTTGTTAAGTTAGTGGC TGTTTAGCTTGCCTCGTCC
TUM1 ko RTAATCTCTGTTTTCAGCAATCCACTCGGGCCCGGATTTCAAGACCCACTGAATTCGAGCTCGTTTAAAC
TUM1 in FCCAGCTTTTCATACTTTCTACC
TUM1 in RTCTGTACCTTCGAATCTACCG
TUM1 out FCCAGCTTTTCATACTTTCTACC
TUM1 out RGGTTTAATCGTGTTGGAATTTCG
TUM1 self FTATGACCATGATTACGCCACTTGATCCCTCCTTTGTTGC
TUM1 self RGTCGACCTGCAGGCATGCAACTTGTGCCATTCGTTATCA
TUM1 his FCGACGACGACAAGGCCATGGCTGATCCATTATTTGATCTTATTTCTCCAAAAG
TUM1 his RCAGTGGTGGTGGTGGTGGTGCTCGATTAATCTCTGTTTTCAGCAATCCA
YCH1 ko FGGACTCGTACTCAATAACAAACGTAAAATACCTGGATCCGACTGAATTAACTGTGGGAATACTCAGGT
YCH1 ko RTCAACGCCACAGATCGGGTAGGTAACCCGCCGTAACGCTCTCGTCGTCACATATCGACTACGTCGTTAAGG
YCH1 in FCACTACTACGCTGAGGGAG
YCH1 in RAAACCTGTCAACGCCACA
YCH1 out FGTGTCTGCTGTGCTTTGTACTA
YCH1 out RAAACCTGTCAACGCCACA
YCH1 self FTATGACCATGATTACGCCAGTGTCTGCTGTGCTTTGTACTA
YCH1 self RGTCGACCTGCAGGCATGCACATGCGTACATATGTGGCT
YCH1 his FCGACGACGACAAGGCCATGGCTGATGACTCGTACTCAATAACAAACGTAAAATAC
YCH1 his RCAGTGGTGGTGGTGGTGGTGCTCGA AAACCTGTCAACGCCACA
UBA4 ko FATGAATGACTACCATCTCGAGGATACCACGTCTGAACTTGAAGCATTAAG GCTTCGTACGCTGCAGGTC
UBA4 ko RCTAATATTTAGGAATGGTTTGATCAATATCGTCTATGTATTTGAAGTATC CCAATACGCAAACCGCCTCT
UBA4 in FCTGCAAAAGGAAGTAAATAGAAG
UBA4 in RGGGTTCAGTTTCGTGATATA
UBA4 out FCTGCAAAAGGAAGTAAATAGAAG
UBA4 out RTATTTAGGAATGGTTTGATCAAT
UBA4 self FTATGACCATGATTACGCCATTTTACAGCTTTAGACACAGG
UBA4 self RGTCGACCTGCAGGCATGCAAAATATTTCCATCATGCGAC
UBA4 his FCGACGACGACAAGGCCATGGCTGATAATGACTACCATCTCGAGG
UBA4 his RCAGTGGTGGTGGTGGTGGTGCTCGACTAATATTTAGGAATGGTTTGATCAATA
RDL2 106A FGAATTGATTTTTCTTgcTGCGAAAGGAGTAAGAGC
RDL2 106A RGCTCTTACTCCTTTCGCagcAAGAAAAATCAATTC
RDL2 106S FGAATTGATTTTTCTTtcTGCGAAAGGAGTAAGAGC
RDL2 106S RGCTCTTACTCCTTTCGCagaAAGAAAAATCAATTC
PspE FATCTAAGTTTTAATTACAAAATGTTTAAAAAAGGCTTACTTGCTCT
PspE RCTAATTACATGAGAGCTCGG TTAACCTTTGACCTTCGGCATTG
GlpE FATCTAAGTTTTAATTACAAAATGGATCAGTTCGAATGTATTAACGTTGCCGAC
GlpE RCTAATTACATGAGAGCTCGG TTACGCGCCGTACGCCACC
RdhA FATCTAAGTTTTAATTACAAA ATGAGCGACACCTTCCAGCG
RdhA RCTAATTACATGAGAGCTCGG CTACTCCGCTTCGCCGCTG
SseA FATCTAAGTTTTAATTACAAA ATGTCCGTTTTCTCCGACC
SseA RCTAATTACATGAGAGCTCGG TCAAACCTCTACAGGGGTATCG