TABLE 3

Primer sequences used for amplification of FBDP-coding sequences and their cloning into A. gossypii expression vector pRS-AgTEF

PrimerSequence (5′ to 3′)Parental plasmidReference
CGL2 fwd SalIGGGGGGGTCGACATGCTCTACCACCTTTTCGTCAACpET24b-CGL262
CGL2 rev AscIGGGGGGGGCGCGCCCTAAGCAGGGGGAAGTGGG
CCL2 fwd SalIGGGGGGGTCGACATGGACTCCCCAGCTGTGACpET24b-CCL218
CCL2 rev AscIGGGGGGGGCGCGCCCTAGACCTTCTCGATGACCC
TAP1 fwd XhoIAAAAAACTCGAGGTCGACATGTCCTACACCCTCCACCTCCGTpET24b-TAP128
TAP1 rev AscIAAAAAAGGCGCGCCTCAAAGATACTCAACCGTAGCCCT
MOA fwd SalIGATGTCGTCGACCATATGTCTCTGCGACGCGGAATTTACpET22-MOA35
MOA rev AscIGTATTAGGCGCGCCCTCAGTAGAAGGCCATGTAGCTGTC
AAL fwd SalIGGGGGGGTCGACATGCCTACCGAATTCCTCTACpET28b-AAL28
AAL rev AscIGGGGGCGCGCCTTACCATCCCGCGGGAGTG
Tam1 fwd SalITTTTTTGTCGACATGAAAGACGTCCAATCTCTCCTCACCpET24b-Tam133
Tam1 rev AscITTTTTTGGCGCGCCTCACTCGAACTTCAACCCGCGACG