TABLE 2

Primers used in this study

Primer nameSequence (5′ to 3′)
xoxF-upstFCGAATTCCTGCAGCCCGGGGGATCCAGTTCCATGCTTTCCTCG
xoxF-upstRCCAGACCTTCAACTTGCGATGAGCCAGC
xoxF-dwstFATCGCAAGTTGAAGGTCTGGGTGCGGTG
xoxF-dwstRCGGCCGCTCTAGAACTAGTGGATCCGGCTTGTTGTGATAGACCAG
PheS-FCTAGCTAGAGGATCGATCCTCTGCAGTTGACAGCTAGC
PheS-RTTGCGTTTTTACAGCTGTCGTCAGAAGGGTTTGAACTG
iPCR-pJQRAGGATCGATCCTCTAGCTAGA
iPCR-pJQFCGACAGCTGTAAAAACGCAAAAGAAAATGCCGA
pPheS-FACCCGTTTTTTTGGGCTAGCCTGCAGTTGACAGCTAGC
pPheS-RGTGGATCCCCCGGGCTGCAGTCAGAAGGGTTTGAACTG
Scr-FGTTGCAAGACCGTTGAGATAGCGTTCCTCG
Scr-RAGCCGTCGAACATGGCGATC
Scr-R2CAGCGGGACGTGATATTTCCTCAGCAGAGC