TABLE 2

Primers for site directed mutagenesis of pET9a-LipT6WT plasmid

PositionOriginal aaaSubstitutionNucleotide sequence 5′→3′b
11IWGCTAACGATGCGCCATGGGTACTTCTCCACGGG
154HYTTTGAAGGCGGACATTATTTTGTGTTGAGCGTG
WTTTGAAGGCGGACATTGGTTTGTGTTGAGCGTG
184LFGATCGCTTTTTTGACTTCCAGAAGGCGGTGTTG
YCGATCGGTTTTTTGACTATCAGAAGGCGGTGTTG
187AFGACTTGCAAAAATTCGTGTTGAAAGCAGCGGC
YGACTTGCAAAAATACGTGTTGAAAGCAGCGGC
215RFGACCAATGGGGACTGTTTCGCCAGCCAGGTGAA
YGACCAATGGGGACTGTATCGCCAGCCAGGTGAA
226FYGAATCATTCGACCAATATTATGAACGGCTCAAACGG
268FYCGAATACGTATTATTTGAGCTATGCCACAGAACGGACG
330KWATGAACGGACCATGGCGAGGATCGACAGAT
YATGAACGGACCATATCGAGGATCGACAGATCGG
360LFACAATGTAGATCATTTCGAAGTCATCGGCGTTG
YCGTACAACGTAGATCATTATGAAGTCATCGGCGT
380LFGCCTTTTATTTGCGATTTGCAGAGCAGTTGGCG
L184F/A187FcLFCGCTTCTTCGACTTCCAAAAATTCGTGTTG
  • a aa, amino acid.

  • b Positions of alterations in mutagenesis primers are indicated in bold.

  • c Used for the combination of L184F/A187F, while A187F (underlined) was used as the template.