TABLE 1

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerRelevant characteristics or sequenceaReference
Strains
    Acetobacter fabarum
        DsW_054From D. suzukii gut44
        108A11Tn5::ppdKThis study
        108A11c108A11 plus pMQ97-Tc-ppdKThis study
        12A2Tn5::ppdK41
        12A2c12A2 plus pMQ97-Tc-ppdKThis study
        66G2Tn5::ppdK41
        ldh1 (10B7)Tn5::ldh41
        ldh2 (92G1)Tn5::ldh41
        adh1 (21G4)Tn5::adh41
        adh2 (5F1)Tn5::adh41
        als (36G1)Tn5::als41
        aldC (26G11)Tn5::aldC41
        pdc (63F5)Tn5::pdc41
    Acetobacter tropicalis DmCS_007From D. melanogaster gut49
    Lactobacillus brevis DmCS_003From D. melanogaster gut49
    Escherichia coli S17-1 (λ-pir)Conjugation donor67
    Saccharomyces cerevisiae InvSc1URA66
Plasmids
    pRL27Tn5 delivery vector; Kmr64
    pKO3Tcr65
    pMQ97RK2 ori, URA3, 2 μm66
    pMQ97-TcTcrThis study
    pMQ97-Tc-ppdKppdK with native promoterThis study
Primers
    ExtsxGACAACAAGCCAGGGATG68
    IntsxCGCACTGAGAAGCCCTTAGAGC68
    Arb1GGCCACGCGTCGACTAGTACN10GATAT65
    Arb2GGCCACGCGTCGACTAGTAC65
    Arb6GGCCACGCGTCGACTAGTACN10ACGCC65
    Tc_FwdGTGAATCCGTTAGCGAGGTGCThis study
    Tc_RevCCGATCTCGGCTTGAACGAATTGThis study
    ppdK_YC_FwdCGTAACAAACGGATAGAACCACThis study
    ppdK_YC_RevCGGAAACGAGGTGGAGAGTAAGThis study
  • a Kmr, kanamycin resistance; Tcr, tetracycline resistance.