TABLE 1

Sequences of primers used for RT-qPCR

Organism, geneGene identifierSequence
ForwardReverse
T. atroviride
    lae1319344AACGCCCCTTTCTGTAACCTGCGACTAGCTCATCCTGGAC
    napA39837AATGGCAGGAGAAAAGCTGAGATTAGCCAGCCACTGCTTC
    metR314604GTGGACGAATACGCCAAACTTAGCGTGCTGCCAATAACTG
    DNA pol53190GAGTGGCGTATGTCATGGTGGCGTCTTCTTGGCAAACTTC
D. melanogaster
    toll1CG5490CCCAACAAACACCTGAACGGTCACAAGGTTGCCCAAGTT
    dsrCG10810GTACTTGTTCGCCCTCTTCGATTTAGCATCCTTCGCACCA
    dptBCG10794ATCCTGATCCCCGAGAGATTCGTTGAGGCTCAGATCGAAT
    18S rRNAFBgn0061475GGTCTGTGATGCCTTTAGATGTCCGACCTCTCGGTCTAGGAAATACAC