TABLE 3

Primer sequences used in this study

FunctionSequence (5′→3′)
Screening sco2120-21 positive library cosmid
    sco2120-Hybrid-FAGGCGTTCGGCGATCTGCT
    sco2120-Hybrid-RTCACCGCCGACCTCACCATC
Gene mutation
    sco2120-Target-FCCCGAGCGGCGGGACCCCGGCCGCCGGGACCCGATCAAGGTCATGATTCCGGGGATCCGTCGACC
    sco2120-Target-RGGGGTCGTCGGTGCCCGCGGCGGGGGCCGGTTCGGAGGCCAGGCGTGTAGGCTGGAGCTGCTTC
    sco2121-Target-FGCCACCGCCTACTCCGGCTTCGCCCGCCCCTGGCTCGCCGTCGCCATTCCGGGGATCCGTCGACC
    sco2121-Target-RGGGCACCGAAATCAGCTCGGCCGTGCCGCCGAGGTCGCGCAGCCGTGTAGGCTGGAGCTGCTTC
    sco2120-21-Target-FAGTTCGGACGGCACCGGACACGGGGGCCCGGGGAGGGGGGACATGATTCCGGGGATCCGTCGACC
    sco2120-21-Target-RCCTTTGCCAGGGTGGGTGGTTGAGGCCACTGTCCCGCGTGGGTCATGTAGGCTGGAGCTGCTTC
    sco4011-Target-FGCTTCCGCTTTTTCTCGGGGCAGCTGAGTAGGCGTACTCATGATTCCGGGGATCCGTCGACC
    sco4011-Target-RTCACCTGAGGGGCGACCCGCCCCGACCGCTCCCCGTGCAGCCTGTAGGCTGGAGCTGCTTC
    sco4924 L-FACCCGGGGATCCTCTAGAGATTGCTCTAGAGCAGGGCCGTGCTGCTGAGG
    sco4924 L-RACTGAGCGTCCATGTCACCAGCGTGGGGCT
    sco4924 Apr-FTGGTGACATGGACGCTCAGTGGAACGAA
    sco4924 Apr-RGGCCGAGGACGATCAGCCGTCCAAATGC
    sco4924 R-FACGGCTGATCGTCCTCGGCCTGGGCTGAGC
    sco4924 R-RGCATGCCTGCAGGTCGACGATACCCAAGCTTGGGTGTCGGCCAGGCACTGG
    sco6728 L-FACCCGGGGATCCTCTAGAGATTGCTCTAGAGGACATGCCGAGCGGTTCCA
    sco6728 L-RACTGAGCGTCCGTCATGCCGTCCACCCT
    sco6728 Apr-FCGGCATGACGGACGCTCAGTGGAACGAA
    sco6728 Apr-RCCGGGACCTAGATCAGCCGTCCAAATGC
    sco6728 R-FACGGCTGATCTAGGTCCCGGACCCCGGAGC
    sco6728 R-RGCATGCCTGCAGGTCGACGATACCCAAGCTTCGATGGCGGCGTCCACGA
Gene mutation analysis
    sco2121-Confirm-FCTTCTTCGCCACCGCCTACTC
    sco2121-Confirm-RTCACTCATGGTCCGCTGCCTT
    sco2120-21-Confirm-FCAAGAACGACAAGGCAGCGA
    sco2120-21-Confirm-RTTTGCCAGGGTGGGTGGTTG
    sco2120-Confirm-FACGGTGTCGCCCTCCAGGG
    sco2120-Confirm-RTGGTCGAGGACGAACCG
    sco4011-Confirm-FGTTCAAATCCCTCCGCCTCC
    sco4011-Confirm-RCCTCCCTGCGCCAACTTTT
    sco4924-Confirm-FGTGGGCGCACAGAAGAGGAAC
    sco4924-Confirm-RCGCAGCCGATCACCAAAGC
    sco6728-Confirm-FCCGCCCCAGTACCGCAGGAT
    sco6728-Confirm-RGGCATCGGCTTCCGGGTG
Gene complementation
    sco2120-21-Com-FCCAAGCTTCAGGGTGGGTGGTTGAGG
    sco2120-21-Com-RCCAAGCTTATCTACCCCGAGGGCACC
    sco2120-Com-FCCCAAGCTTGAGGAACGGGAGGGGACGGA
    sco2120-Com-RCCCAAGCTTGGCGAGGTTGTCCTTGATGC
    sco2121-Com-FCCCAAGCTTCCGCTACCAGGGCATGGAGC
    sco2121-Com-RCCCAAGCTTCGTGTCGTTCGGGGTCGTGT
    sven1780-81-Com-FCCCAAGCTTGCCATGATCGACACGGAGAAG
    sven1780-81-Com-RCCCAAGCTTGACGGAGTACGGCGAGTAGGAC
    sav_6081-82-Com-FCCCAAGCTTTCACGACTCCCGGCATCAA
    sav_6081-82-Com-RCCCAAGCTTAACCGCGAGGTCACATAGGC
    sco4011-Com-FCCCAAGCTTGTTCAAATCCCTCCGCCTCC
    sco4011-Com-RCCCAAGCTTCCTCCCTGCGCCAACTTTT
    sco4924-Com-FCCCAAGCTTCCCGAAGAAGCACGGCAACA
    sco4924-Com-RCCCAAGCTTTCGACACCGCTCACGAGGAC
    sco6728-Com-FCCCAAGCTTCCGCCCCAGTACCGCAGGAT
    sco6728-Com-RCCCAAGCTTGGCATCGGCTTCCGGGTG
Protein expression
    sco2120-Exp-FCATATGATGGTGGTCGACGACCAC
    sco2120-Exp-RCTCGAGTCAGGCGTCGTCCAGACC
SCO2120-Flag
    sco2120-Flag-RCTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCGGCGTCGTCCAGACCCCGTTCGAT
    sco2120-Flag-FGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGTGACCCACGCGGGACAGTGGCCTC
    sco2120-Linker-RACTACCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCGGCGTCGTCCAGACCCCGTTCGAT
    sco2120-Linker-FGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGTAGTGACTACAAAGACCATGACGGTGAT
For EMSA analysis
    EMSA sco0607-59bp FCGGGTCGTACGGCTCGTCCGATTGAGTACCCGTACTCATGAGGTGCCTCCCCCCGACGG
    EMSA sco0607-59bp RCCGTCGGGGGGAGGCACCTCATGAGTACGGGTACTCAATCGGACGAGCCGTACGACCCG
    EMSA sco1700-59bp FGCGCCACATCCGCCGTCGTACTCAGTTCGCGTACTCAGACCCCGGTGGTCAGAAGGCCG
    EMSA sco1700-59bp RCGGCCTTCTGACCACCGGGGTCTGAGTACGCGAACTGAGTACGACGGCGGATGTGGCGC
    EMSA sco2101-C-59bp FCCGCCGACCGGTCACCTGGACGTCCGTTCCGGTGCTCAGCCCTCGCACGGGGGTGCCGG
    EMSA sco2101-C-59bp RCCGGCACCCCCGTGCGAGGGCTGAGCACCGGAACGGACGTCCAGGTGACCGGTCGGCGG
    EMSA sco4011-59bp FGCTTCCGCTTTTTCTCGGGGCAGCTGAGTAGGCGTACTCATGTGCCCGTTCCGTGTGCG
    EMSA sco4011-59bp RCGCACACGGAACGGGCACATGAGTACGCCTACTCAGCTGCCCCGAGAAAAAGCGGAAGC
    EMSA sco4225-59bp FGGGTACCGCGACACCCCGGACTTGAGTACGGGTACTCAGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M1 FGGGTACCGCGACACCCCGGACTGTGATACGGGTACTCAGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M1 RACCGGGAGCCCGCCCCGGGCCTGAGTACCCGTATCACAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp M2 FGGGTACCGCGACACCCCGGACTGTGATACGGGTAGATTGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M2 RACCGGGAGCCCGCCCCGGGCCAATCTACCCGTATCACAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp M3 FGGGTACCGCGACACCCCGGACTGTGAAGTGGGTAGATTGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M3 RACCGGGAGCCCGCCCCGGGCCAATCTACCCACTTCACAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp M4 FGGGTACCGCGACACCCCGGACTTGAGAGTGGCAGCTCAGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M4 RACCGGGAGCCCGCCCCGGGCCTGAGCTGCCACTCTCAAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp M5 FGGGTACCGCGACACCCCGGACTTGAGAGTGGCAGGATTGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp M5 RACCGGGAGCCCGCCCCGGGCCAATCCTGCCACTCTCAAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp Me FGGGTACCGCGACACCCCGGACTATAACAGGGCTGTTATGGCCCGGGGCGGGCTCCCGGT
    EMSA sco4225-59bp Me RACCGGGAGCCCGCCCCGGGCCATAACAGCCCTGTTATAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4225-59bp RACCGGGAGCCCGCCCCGGGCCTGAGTACCCGTACTCAAGTCCGGGGTGTCGCGGTACCC
    EMSA sco4924-59bp FGGCTTGGCCGAGGGGGGTGACTTGAGTACGGGTACTCAAATCGGGGCGCGGGGTTCCTC
    EMSA sco4924-59bp FGAGGAACCCCGCGCCCCGATTTGAGTACCCGTACTCAAGTCACCCCCCTCGGCCAAGCC
    EMSA sco6728-59bp FATTCGAACACCCAGCGGGATCTGAGTATCCGTACGGATGTGCCATCCCCGCGGTCCCGG
    EMSA sco6728-59bp RCCGGGACCGCGGGGATGGCACATCCGTACGGATACTCAGATCCCGCTGGGTGTTCGAAT
    EMSA sco7460-59bp FGCGGCGGCACTCAGGACGCGGATGAGTTCCCGTACTCATCCGCGGTGCCGGGCACGGCT
    EMSA sco7460-59bp RAGCCGTGCCCGGCACCGCGGATGAGTACGGGAACTCATCCGCGTCCTGAGTGCCGCCGC
    EMSA sco7613-59bp FACCCCGCCTCTGAGTACGGGCTGAGTATGCGCGCTCATGTCCCGACGCGTGGCGAGGAC
    EMSA sco7613-59bp RGTCCTCGCCACGCGTCGGGACATGAGCGCGCATACTCAGCCCGTACTCAGAGGCGGGGT
Real-time PCR analysis
    sco0607Realtime FCAGTGCGTGTGTGCCCAA
    sco0607Realtime RCGGTGTGTGTCTGCCAGT
    sco1700Realtime FCCACCGCCATCGGCATCTAC
    sco1700Realtime RTCTGGAAGGGGTCGTGCTCG
    sco4011Realtime FGACCTGCCTGTCGCTCCACC
    sco4011Realtime RAGGAACCACAGCCCGAGGA
    sco4225Realtime FCGCCTGACCCTCGCCAAC
    sco4225Realtime RCGGGAAGGTGAACAGGGC
    sco4924Realtime FCCGACCCCGAGAACGAGCCG
    sco4924Realtime RGCCCAGGCCGAGGACGACCA
    sco6728Realtime FATGACGACACACCGTGCA
    sco6728Realtime RTAGATCATCCCGCCGATC
    sco7460Realtime FCGCTCCTGGCCGGGCTGCTG
    sco7460Realtime RCGTCGCAGCGGTCCTTGCCG
    sco7613Realtime FATGACGAACCTTCCGCCCCC
    sco7613Realtime RTCGCCTGCAACGTGTGGACC
Footprinting analysis
    sco0607FP FCGAACGGCCGCGGACGCCGT
    sco0607FP RCCAGGACGAGACCGGGAACG
    sco2101FP FGCGGAAGGAGCGGATCGCGG
    sco2101FP RGGACTTTATCCGCCGCCACC
    sco4011FP FCGGCAGTCATGTAATGTTCTT
    sco4011FP RGTCCATGTCCGCCACCCT
    sco4225FP FCCGTCGGCCGAGGCGGTCCA
    sco4225FP RGTCGGCTCGGGCGTTGTT
    sco6728FP FGAAGGAACTTCATGCCTTCA
    sco6728FP RAGCACGAGACCCGCGACCAC
    sco7460FP FCTTCACGCGCGGGCACCTCTC
    sco7460FP RGCGAGCCCCCCGCCGACGCG
Chip-qPCR analysis
    sco0607Chip-qPCR FGCCGACTGGACCGACTGG
    sco0607 Chip-qPCR RCGGGTTGCTGGTACGCAC
    sco1700Chip-qPCR FCCGCCGTGTTCTGCTGCTT
    sco1700Chip-qPCR RGTGCGCTGACCGGGGTTT
    sco2101Chip-qPCR FCGCGTACTCATCTGCCGCACTA
    sco2101Chip-qPCR RGGACTTTATCCGCCGCCACC
    sco4011Chip-qPCR FCGAATCCTGCCGAGTGCA
    sco4011Chip-qPCR RGGTGGTGGCGTCGAACGC
    sco4225Chip-qPCR FGGTCGTGCTCCTGAACCA
    sco4225Chip-qPCR RCCACAAGGCGGACGAGAT
    sco4924Chip-qPCR FTTGGGCGGCTCGTTCTCG
    sco4924Chip-qPCR RTGTCGATTTGCGGCTCCG
    sco5085Chip-qPCR FATCAATAGGAGATCGCTTGT
    sco5085Chip-qPCR RCCGCATCGGTGATTACAT
    sco6728Chip-qPCR FACTTGGCCGCACATCACG
    sco6728Chip-qPCR RTGTCGTCATGCCGTCCACC
    sco7460Chip-qPCR FTCGGTCACCGCGAACACTA
    sco7460Chip-qPCR RCGACGGCGCCACGATATG
    sco7613Chip-qPCR FGGGGCGGAAGGTTCGTCA
    sco7613Chip-qPCR RAGTTGGCCGACTCGTGGG
    hrdBChip-qPCR FCGCCGAGTCCGTCTCTGTCA
    hrdBChip-qPCR RGCTCTGCGGCACTGACCATC
BACTH analysis
    BTH sco4011 FGCTCTAGATATGTGCCCGTTCCGTGTGCG
    BTH sco4011 RTTATCGATTCACCTGAGGGGCGACCCG
    BTH sco4225 FGCTCTAGATATGAACAGCACCCAGCCGAA
    BTH sco4225 RTTATCGATTCAGTGCGCCGTCGTCAGGT
    BTH sco4924 FGCTCTAGATATGCTGTGGTCCGACCCCGA
    BTH sco4924 RTTATCGATTCAGCCCAGGCCGAGGACGA
    BTH sco6728 FGCTCTAGATATGACGACACACCGTGCACC
    BTH sco6728 RTTATCGATTCACCCGGACCACCCGGCGATC
RACE analysis
    sco2121Race outerACGGACCCGGCGGTCCATAT
    sco2121Race innerGTGAGGTCGGCGGTGAGGAA