TABLE 3

Primers used in this study

Primer by useSequence (5′–3′)
EMSA
    EMSA_CLIB_00130_Ext_FwCTGTTTTCTTCGAGGTTGGTG
    EMSA_CLIB_00130_Ext_RvCCGCATTAAACGCCTTACAA
    EMSA_CLIB_00130_FwCTGATGGTCCGTTTGCTTCT
    EMSA_CLIB_00130_Rv_BioTGCAGAACCCGACTCTATCTG
Cloning, two-hybrid system, and site-directed mutagenesis
    CLIB_01505_Ext-FwAAAAATCCGTAGAAAGGCAGT
    CLIB_01505_Ext-RvTTGCGAATCTATTGATGTCAGG
    CLIB_01505_LIC-FwTTGTATTTCCAGGGCATGACATACGTCGTCACTGAAAA
    CLIB_01505_LIC-RvCAAGCTTCGTCATCATTATGTATTTTTTCCCCCAGGA
    CLIB_01505_SphI_FwCCGGCATGCATGACATACGTCGTCACTGAAAA
    CLIB_01505_BamHI_RvCCGGGATCCTTATGTATTTTTTCCCCCAGGA
    CLIB_01505_Y3A_FwATGCATGACAGCCGTCGTCACTG
    CLIB_01505_Y3A_RvGCATATGGATCGATCCTG
    CLIB_01505_V20A_FwCATACAGATTGCGTGGAAGCTTGTCCTGTCGATTGTTTT
    CLIB_01505_V20A_RvAAAACAATCGACAGGACAAGCTTCCACGCAATCTGTATG
    CLIB_01505_C21A_FwACAGATTGCGTGGAAGTTGCTCCTGTCGATTGTTTTTAC
    CLIB_01505_C21A_RvGTAAAAACAATCGACAGGAGCAACTTCCACGCAATCTGT
    CLIB_01505_V23A_FwTGCGTGGAAGTTTGTCCTGCCGATTGTTTTTACGAAGGA
    CLIB_01505_V23A_RvTCCTTCGTAAAAACAATCGGCAGGACAAACTTCCACGCA
    CLIB_01505_D24A_FwGTGGAAGTTTGTCCTGTCGCTTGTTTTTACGAAGGAGAA
    CLIB_01505_D24A_RvTTCTCCTTCGTAAAAACAAGCGACAGGACAAACTTCCAC
    CLIB_01505_C40A_FwGCAATCCATCCAGATGAGGCCATAGATTGTGGGGTATGC
    CLIB_01505_C40A_RvGCATACCCCACAATCTATGGCCTCATCTGGATGGATTGC
    CLIB_01505_D42A_FwCATCCAGATGAGTGCATAGCTTGTGGGGTATGCGAGCCC
    CLIB_01505_D42A_RvGGGCTCGCATACCCCACAAGCTATGCACTCATCTGGATG
    CLIB_01505_C43A_FwCCAGATGAGTGCATAGATGCTGGGGTATGCGAGCCCGAA
    CLIB_01505_C43A_RvTTCGGGCTCGCATACCCCAGCATCTATGCACTCATCTGG
    CLIB_01505_V45A_FwTGCATAGATTGTGGGGCATGCGAGCCCGAATGC
    CLIB_01505_V45A_RvGCATTCGGGCTCGCATGCCCCACAATCTATGCA
Cotranscription assay
    CLIB_01505_RTPCR_FwGCATACAGATTGCGTGGAAGT
    CLIB_01505_RTPCR_RvCCCCACAATCTATGCACTCAT
    CLIB_01510_RTPCR_FwCTGCCCATGGAGTAGGAACTATTAC
    CLIB_01510_RTPCR_RvATCTTGTCCTTGTCAAATGCAATAA
Sequencing
    T7TAATACGACTCACTATAGGG
    T7 termGCTAGTTATTGCTCAGCGG
    pB2H_Omega_FwCTCAAGCTTACTCCCCATCC
    pB2H_Omega_RvGGCGATTAAGTTGGGTAACG
    pB2H_Alpha_FwGACAATTAATCATCGGCTCGT
    pB2H_Alpha_RvGACAGTATCGGCCTCAGGAA