TABLE 4

Primers

PrimeraFunctionNucleotide sequence (5′to 3′)b
adhE (BamHI)-FConstruction of pET28a-adhECGGGATCCATGATTAAGACAGAAAAAAATCAAACAAGC
adhE (NotI)-RConstruction of pET28a-adhEAAGGAAAAAAGCGGCCGCCTATTTTTCAGTACCTTG
lysR (BamHI)-FConstruction of pET28a-lysRCGCGGATCCATGAAGACAACTCAAGAAAGTAT
lysR (XhoI)-RConstruction of pET28a-lysRCCGCTCGAGTTTTTGATTAATCTTTTGTAACCG
acrR (NcoI)-FConstruction of pET28a-acrRCATGCCATGGCAATGATGGTAAAGAGAAGAAC
acrR (XhoI)-RConstruction of pET28a-acrRCCGCTCGAGTTTTTTCGTCTTATCAGCAGGTAAG
rex (NcoI)-FConstruction of pET28a-rexCATGCCATGGCAGAAACAAAAATTCCACGG
rex (XhoI)-RConstruction of pET28a-rexCCGCTCGAGATCTTCAGTCTCATTTTCATCGTC
△adhE up (EcoRI)-FConstruction of pMG36c(MK)-△adhECGGAATTCCTCGAGACTGGTATAATGGCAG
△adhE up-RConstruction of pMG36c(MK)-△adhETCTCGTTCATGAAGTGCTTCCTCCGTTC
△adhE emr-FConstruction of pMG36c(MK)-△adhEAGGAAGCACTTCATGAACGAGAAAAATATAAAAC
△adhE emr-RConstruction of pMG36c(MK)-△adhEATTCACAAAGGGCTTATTAAATAATTTATAGCTATTG
△adhE down-FConstruction of pMG36c(MK)-△adhEATTTAATAAGCCCTTTGTGAATTAAGGG
△adhE down (XbaI)-RConstruction of pMG36c(MK)-△adhEGCTCTAGAATCATAGTCATCAGTCAACAC
△adhE up up-FChecking the adhE mutationCCCAAATCTTTTAAGTGTTGAGCAG
△adhE down down-RChecking the adhE mutationGATTATATGCGTGTGAGAAATGGTGC
adhE (PstI)-FConstruction of pMG36c (M)-adhEAACTGCAGATGATTAAGACAGAAAAAAATC
adhE (KpnI)-FConstruction of pMG36c (M)-adhEGGGGTACCCTATTTTTCAGTACCTTG
△acrR up (XbaI)-FConstruction of pMG36c(MK)-△acrRTGCTCTAGATTAACAACGTGTTAGCTGGTAAGGCC
△acrR up-RConstruction of pMG36c(MK)-△acrRGAAATGTTGAATACTCATCATGCTCCCCCATTTATC
△acrR amp-FConstruction of pMG36c(MK)-△acrRGATAAATGGGGGAGCATGATGAGTATTCAACATTTC
△acrR amp-RConstruction of pMG36c(MK)-△acrRGCCGCACTGAATCTTAAATTACCAATGCTTAATCAG
△acrR down-FConstruction of pMG36c(MK)-△acrRCTGATTAAGCATTGGTAATTTAAGATTCAGTGCGGC
△acrR down (PstI)-RConstruction of pMG36c(MK)-△acrRAAAACTGCAGCGCATCATAGTGGAAATTAACAGTC
△acrR up up-FChecking the acrR mutationGATATTTTACGGAAATATCACGAGGCAGCCTACGAT
△acrR down down-RChecking the acrR mutationCAACGCGTTCAAAAACTAACTTGCCACTAGTAATCG
acrR (PstI)-FConstruction of pMG36c (MK)-acrRAAAACTGCAGGCATTTTAAAACTGGATTATTAA
AcrR (KpnI)-RConstruction of pMG36c (MK)-acrRCGGGGTACCTTATTTTTTCGTCTTATCAGC
O-acrR (PstI)-FConstruction of pMG36c (M)-acrRAAAACTGCAGGATGATGGTAAAGAGAAGAAC
O-acrR (KpnI)-RConstruction of pMG36c (M)-acrRCGGGGTACCTTATTTTTTCGTCTTATCAGC
O-rex (PstI)-FConstruction of pMG36c (M)-rexAAAACTGCAGTATGGCAGAAACAAAAATTC
O-rex (KpnI)-RConstruction of pMG36c (M)-rexCGGGGTACCTTAATCTTCAGTCTCATTTTC
QadhE-FqRT-PCR analysis of adhETCCGTATGGTGCATCAAGGC
QadhE-RqRT-PCR analysis of adhEAATGTAGTTCTGCGGCTGCT
Q16s-FqRT-PCR analysis of 16S rRNA-encoding geneGAGCCGAAACCCTTCTTCAC
Q16s-RqRT-PCR analysis of 16S rRNA-encoding geneACATTGGGACTGAGACACGG
PadhE-F (PstI)Construction of Blunt-PadhEAACTGCAGTCAAGACTCGGGACAGGG
PadhE-R (KpnI)Construction of Blunt-PadhEGGGGTACCGAAGTGCTTCCTCCGTTC
Blunt-F (Biotin)Preparing biotinylated vector and vector-PadhE5′-(biotin)TACGACTCACTATAGGGCGAATTG
Blunt-RPreparing biotinylated vector and vector-PadhETTCACACAGGAAACAGCTATGACC
  • a F, forward; R, reverse; PadhE, promoter of adhE.

  • b The underlined nucleotide sequences are the restriction sites.