TABLE 2

Primers used in this study

PrimeraSequence (5′–3′)Description
Smu_833 pGEM FCTTCCTGAAAAGGGTTATCTATATGsmu_833 deletion
Smu_833 pGEM RACCTAACGCAAAAGACAAGGsmu_833 deletion
Smu_833 Xba1 Inv FCGCGTCTAGAAGGCTATAGGCATTTATTTAGAAsmu_833 deletion
Smu_833 Xba1 Inv RCGCGTCTAGATTTTCCCCCTTGAAAATTAATAATTGGsmu_833 deletion
Smu_833 Kpn1 FCGCACGGGTACCATGAAAAAACTTTCAATAGsmu_833 complement
Smu_833 BspH1 RGGTCAGTCATGAGTCCTTTTTCCTTAACsmu_833 complement
16S rRNA FCTTACCAGGTCTTGACATCCCqRT-PCR
16S rRNA RCCAACATCTCACGACACGAGqRT-PCR
gtfB FACACTTTCGGGTGGCTTGqRT-PCR
gtfB RGCTTAGATGTCACTTCGGTTGqRT-PCR
gtfC FCAAAATGGTATTATGGCTGTCGqRT-PCR
gtfC RTGAGTCTCTATCAAAGTAACGCAGqRT-PCR
gtfD FCGGTATTCAGGTTATTGCGqRT-PCR
gtfD RCTCACCATAATCGTTGACACGqRT-PCR
  • a F, forward; R, reverse.