TABLE 2

Primers used in this study

PrimeraOligonucleotide sequence (5′–3′)
PggaALF-FTTTTGTATCAAAGCCTATCGT
PggaALF-RGCTAGACAATAAGAGGAGAATTTAAAGTGATGATTGTGATTGGATATG
PggaADR-FCGTATAGCATACATTATACGAACGGCGGTTCATCGCCATCTTCTC
PggaADR-RTAGCGGTAGTCGTTCCTGTT
PggaARF-FCATATCCAATCACAATCATCACTTTAAATTCTCCTCTTATTGTCTAGC
PggaARF-RCGCAGTTTAAACAGGCGTAATAAAGTTCAACCTGCAAAAACAAAAAAAGG
PggaAPS-FCCTTTTTTTGTTTTTGCAGGTTGAACTTTATTACGCCTGTTTAAACTGCG
PggaAPS-RGAGAAGATGGCGATGAACCGCCGTTCGTATAATGTATGCTATACG
PgtaBLF-FTCAAACTCTTCAACGACTCT
PgtaBLF-RGGATTCGGCAGCTTTTTTGAATAACACCATCCTTGT
PgtaBDR-FCGTATAGCATACATTATACGAACGGTGCTTCCAATCGTTGATAAG
PgtaBDR-RGGCGTCCGTTAATTGAATT
PgtaBRF-FACAAGGATGGTGTTATTCAAAAAAGCTGCCGAATCC
PgtaBRF-RCGCAGTTTAAACAGGCGTAATAAGACGGATGTTCAGCTTAATG
PgtaBPS-FCATTAAGCTGAACATCCGTCTTATTACGCCTGTTTAAACTGCG
PgtaBPS-RCTTATCAACGATTGGAAGCACCGTTCGTATAATGTATGCTATACG
PnucBLF-FATCAGGGTCTGCTTTTGTTT
PnucBLF-RAAACTCCGGCGAACCGGAGAAGCTATCACATCCTCCTTAAGAAGT
PnucBDR-FCGTATAGCATACATTATACGAACGGTTGGTGATCTCTCTTCAGTTCG
PnucBDR-RCTCTCGTGCCGTCGGAATA
PnucBRF-FACTTCTTAAGGAGGATGTGATAGCTTCTCCGGTTCGCCGGAGTTT
PnucBRF-RCGCAGTTTAAACAGGCGTAATAAGTTACCGCAGGGGGCCAGAATGATT
PnucBPS-FAATCATTCTGGCCCCCTGCGGTAACTTATTACGCCTGTTTAAACTGCG
PnucBPS-RCGAACTGAAGAGAGATCACCAACCGTTCGTATAATGTATGCTATACG
PyngKLF-FTCCGCCCGCCGTCTAATGTATATAAAAATT
PyngKLF-RAAGCAGAGAGGGGGAAAAACTAGCATTATTAATAAAACTGACAGTTGCGGCGC
PyngKDR-FCGTATAGCATACATTATACGAACGGGAAGCCTGTCAACGGAAGTAACGATAT
PyngKDR-RGGGTGCGGAACTACGATGATTTATACG
PyngKRF-FGCGCCGCAACTGTCAGTTTTATTAATAATGCTAGTTTTTCCCCCTCTCTGCTT
PyngKRF-RCGCAGTTTAAACAGGCGTAATAAGATCATTCTTGCCAGCTACC
PyngKPS-FGGTAGCTGGCAAGAATGATCTTATTACGCCTGTTTAAACTGCG
PyngKPS-RATATCGTTACTTCCGTTGACAGGCTTCCCGTTCGTATAATGTATGCTATACG
PyyaHLF-FGCAGGCTACTTAGGGCT
PyyaHLF-RAGAAAAAAAGGGAGGCGGACATTAACAGTGCGGGGGAAC
PyyaHDR-FCGTATAGCATACATTATACGAACGGCCATCCTCTATCACGCTCTCAT
PyyaHDR-RGCAGCGATATGGGTGAAAGATT
PyyaHRF-FGTTCCCCCGCACTGTTAATGTCCGCCTCCCTTTTTTTCT
PyyaHRF-RCGCAGTTTAAACAGGCGTAATAATTCTGGTCGGATGCCATGATAT
PyyaHPS-FATATCATGGCATCCGACCAGAATTATTACGCCTGTTTAAACTGCG
PyyaHPS-RATGAGAGCGTGATAGAGGATGGCCGTTCGTATAATGTATGCTATACG
P2739LF-FTTACGACGAAAAAGTATCCGAC
P2739LF-RAGGAACATGGTGACTGTCCTTGATATGACATATCGAACACCG
P2739DR-FCGTATAGCATACATTATACGAACGGACCATTCCAGCGTTCTCCAT
P2739DR-RCCGACAGATCATGCCGATTATG
P2739RF-FCGGTGTTCGATATGTCATATCAAGGACAGTCACCATGTTCCT
P2739RF-RCGCAGTTTAAACAGGCGTAATAATTGACCACTCCGTCGTATTC
P2739PS-FGAATACGACGGAGTGGTCAATTATTACGCCTGTTTAAACTGCG
P2739PS-RATGGAGAACGCTGGAATGGTCCGTTCGTATAATGTATGCTATACG
P9906LF-FAGATATCGATCCTGCGATTT
P9906LF-RCGGCTTTTGCGGTCTTTTTATTCAAGAACTCCTTTGCCTT
P9906DR-FCGTATAGCATACATTATACGAACGGAACAGCCAATCTTCAGGAG
P9906DR-RCGTCAGTCGGTGTATAGTC
P9906RF-FAAGGCAAAGGAGTTCTTGAATAAAAAGACCGCAAAAGCCG
P9906RF-RCGCAGTTTAAACAGGCGTAATAACTACTTTGCGCCTTTTTTGG
P9906PS-FCCAAAAAAGGCGCAAAGTAGTTATTACGCCTGTTTAAACTGCG
P9906PS-RCTCCTGAAGATTGGCTGTTCCGTTCGTATAATGTATGCTATACG
P3020LF-FCGTATAACGTTTCTGTCGCATTAC
P3020LF-RCTATTGAAAAGGGGAAAAAGCATAAGAAAAGGTGCCGTTTATCG
P3020DR-FCGTATAGCATACATTATACGAACGGATGAACTCGCTGCCATTGTAA
P3020DR-RGCTCGGATTGATGCTGACTG
P3020RF-FCGATAAACGGCACCTTTTCTTATGCTTTTTCCCCTTTTCAATAG
P3020RF-RCGCAGTTTAAACAGGCGTAATAAGACTTTGAATGGAAACGAAACG
P3020PS-FCGTTTCGTTTCCATTCAAAGTCTTATTACGCCTGTTTAAACTGCG
P3020PS-RTTACAATGGCAGCGAGTTCATCCGTTCGTATAATGTATGCTATACG
ggaA-qFGTCCAAGCCGTCCGTAGAAG
ggaA-qRACAGGAACGACTACCGCTACCT
gtaB-qFCGTTGATAAGCCGACAATTCAG
gtaB-qRCATTGTCGAAATGGTCTTCTATTG
ggaALF-FGAGAAGGCGTCGTAAAC
ggaALF-RTAACGGCAGTAAAGAGGT
ggaACm-FATTCAAAACCTCTTTACTGCCGTTAGCATAAAGTGTAAAGCCTGGGG
ggaACm-RCCTTTCGCTGAAAGTAACAAAATGAAATGTGGAATTGGGAACGGAAA
ggaACG-FTCATTTTGTTACTTTCAGCG
ggaACG-RATACAAACCATTCTGCACATAATCAGAACACAGAAAGCTGATTCT
ggaARF-FTGATTATGTGCAGAATGGT
ggaARF-RTCTCGATAATATGGTAGGC
gtaBLF-FGAGAAGGCGTCGTAAAC
gtaBLF-RTAACGGCAGTAAAGAGGT
gtaBCm-FATTCAAAACCTCTTTACTGCCGTTAGCATAAAGTGTAAAGCCTGGGG
gtaBCm-RAAAACCAGATATCGTTTTGGTCCACAATGTGGAATTGGGAACGGAAA
gtaBCG-FGTGGACCAAAACGATATCT
gtaBCG-RATACAAACCATTCTGCACATAATCACTATTCGTCAGCTTCTTCTT
gtaBRF-FTGATTATGTGCAGAATGGT
gtaBRF-RTCTCGATAATATGGTAGGC