TABLE 2

Primers used in this studya

Primer namePrimer sequenceDescriptionConstruct
Up wza F NheI (Eag)GGATTGGCTAGCATTCATAGCATTCGGCCGATG5′ primer for upstream region of wzapΨ540
Up wza R SphICCTGGATACGACGCATGCCATCATCTAAG3′ primer for upstream region of wzapΨ540
Dn wza F BamHIGCTTGCAGGGCATAATTTTTGGATCCACAAGATTCC5′ primer for downstream region of wzapΨ540
Dn wza R NheI (stop)CCAACTTTAAGAAACAATGATGTAGTCTTAGCTAGCACCAGTGGTTAAACT3′ primer for downstream region of wzapΨ540
Up Wzc F SacIGCACTGTCCCTATGCGAGCTCAAGCCAGTA5′ primer for upstream region of wzcpΨ546
Up wzc R BamHIGCTTGTAAGGCAGGGGATCCACCAACT3′ primer for upstream region of wzcpΨ546
Dn wzc F BamHICGCTTGATCACGGATCCATATCTAGAAATAAAAACCAGTTCAGA5′ primer for downstream region of wzcpΨ546
Dn wzc R Sph RGGTTCATCACTCAAAAGCATGCTGGCATCC3′ primer for downstream region of wzcpΨ546
Up s-layer F BamHIGGGCAGTAAGCGACGGGATCCAGCTCGTTTAAG5′ primer for upstream region of sll1951pΨ543
Up s-layer R NheIGGATTTAATCTCTAAATCTGCTAGCTAAAGTTACGG3′ primer for upstream region of sll1951pΨ543
Dn s-layer F NheIGCACTTTTCAGACACTTGCTAGCGGCCGGGGAAAA5′ primer for downstream region of sll1951pΨ543
Dn s-layer R SphIGGTTGGTCTTACTATAGCATGCAGGTGGTAACGGA3′ primer for downstream region of sll1951pΨ543
Up pilC F BamHICCAATGCTCTGCGGGGATCCTTACGGGAAGATCCG5′ primer for upstream region of pilCpΨ541
Up pilC R NheIGGTCAGATGATTAGGGGGCTAGCACCGAAAAACTTATG3′ primer for upstream region of pilCpΨ541
Dn pilC F NheI (Eag)GCCGCTAGCGTTGTGAAGAGAGTACGGCCGCAC5′ primer for downstream region of pilCpΨ541
Dn pilC R SphIGCGGCATTCCCAAGTAAAGCATGCGCTCTTTAA3′ primer for downstream region of pilCpΨ541
pilC compl F NdeICCCCCTAATCATATGACCCCAAACTATTAAGC5′ primer for pilCpΨ552
pilC compl R SalIGTCACAAGCAATCAGTCGACAGCAGAGC3′ primer for pilCpΨ552
  • a “Up”/“upstream region” and “down”/“downstream region” refer to regions flanking the gene of interest targeted for replacement (see Materials and Methods).