TABLE 2

Primers used in this study

PrimerSequence (5′ to 3′)Description
cat_FATGGAGAAAAAAATCACTGGATATACCACCAmplifies cat gene for allelic exchange knockout screening and for overlap extension PCR to make ΔsrtA mutagenesis cassette (from pDC123 template)
cat_RCCCGCCCTGCCACTCATCGC
cylE_farout_FTACACGCGAGATCGGTTAGCBinds GBS chromosome outside of the cylEmut mutagenesis cassette region, for confirming single- and double-crossover events at the cylE locus
cylE_farout_RCTGGTGTTCCTGAAGCGAGT
cylEmut_GA_FATTGGGTACCGGGCCCCCCCAGATGCTATAAAAGCAGCAmplifies cylEmut mutagenesis cassette (from AR1958 template) for Gibson assembly into pMBsacB NotI/XhoI digest
cylEmut_GA_RTGGAGCTCCACCGCGGTGGCCCTGTTTACTTGTTCCGATAAAAAG
cylEmut_Conf_FCCAACGAAGCCACTGTCTCTSequencing primer to confirm barcoded stop codon in the cylE gene
ΔsrtA_DS_FGCGATGAGTGGCAGGGCGGGGCGTAAAAGGTAGTTAGAATTATGAAATTAAAGGCTGTTCAmplifies downstream homology arm for ΔsrtA mutagenesis cassette; overlap extension PCR compatible
ΔsrtA_DS_RGCGCGCGCCTCGAGGCGTTTTAACTTTCGTGTCTCTAGATTCATCATAATTCAGAAGT
ΔsrtA_GA_FGCTTCCAAGGAGCTAAAGAGGAATTCGAAAAGCCCTGACAmplifies ΔsrtA mutagenesis cassette for Gibson assembly into pMBsacB NotI/XhoI digest
ΔsrtA_GA_RATTCACTACTTTTAGTTAAGTTATTTGTTAACTGTTAATTGTCC
ΔsrtA_US_FGCGCGCGCGGATCCAATTTAGGGCGTGTGTATCGTTTGAAAGCATATAmplifies upstream homology arm for ΔsrtA mutagenesis cassette; overlap extension PCR compatible
ΔsrtA_US_RGGTGGTATATCCAGTGATTTTTTTCTCCATGAAACCATGTGATTTTTTTTTATT
p23sacB_cassette_FGCTTCCAAGGAGCTAAAGAGGTCCTTAACTAAAAGTAGTGAATTTTTGATTTTTGAmplifies p23 promoter-sacB gene from pSacB23 for Gibson assembly into pHY304 AvaII digest
p23sacB_cassette_RAAATTCCCCGTAGGCGCTAGGCATGCGTTATTTGTTAACTGTTAATTGTCC
pMBsacB_MCS_FCAATACGCAAACCGCCTCTCBinds pMBsacB, for use with “farout” primers for confirmation of single-cross insertion
sacB_pORI23_FTATGAATGACAATGATGTTGATGAACATCAAAAAGTTTGCAmplifies sacB from B. subtilis 168 for Gibson assembly into pORI23 BamHI digest
sacB_pORI23_RAGCTTGGCTGCAGGTCGACGTTATTTGTTAACTGTTAATTGTCC
srtA_farout_FAGAGCACAAAAACGTGGAGGBinds GBS chromosome outside of the ΔsrtA mutagenesis cassette region, for confirming single- and double-crossover events at the srtA locus
srtA_farout_RACTGCTAAGGTATCGTTAGACCC