TABLE 2

Primers and DNA fragmentsa

Oligonucleotide function and nameSequence (5′→3′)
Site-directed mutagenesis
    C39A-SGAATTTATGCGGCGGATAAGCGTCCGTGGGTAATTGG
    C39A-ATTATCCGCCGCATAAATTCTTTGAACCTCAGCAACAT
    C146A-STTCGCTGGGCGACCGAGCGTATGAAAATCAATCCGGT
    C146A-ACGCTCGGTCGCCCAGCGAAAACTACGGGTTGGGGCCG
    C262A-SAGGGTGAGGCGCCCCTGGTGATCGACGAAAGTACCCC
    C262A-AACCAGGGGCGCCTCACCCTGTGCGGAAGAATCCATAT
    C273A-SCCCCCTCTGCGGGGAACTCTCGCTTTGGCTGCTGGAC
    C273A-AGAGTTCCCCGCAGAGGGGGTACTTTCGTCGATCACCA
    C280A-SGCTTTGGCGCGTGGACCTGTACCGTAGTCACCAAAGA
    C280A-ACAGGTCCACGCGCCAAAGCGAGAGTTCCCGCAAGAGG
    C283A-SGCTGGACCGCGACCGTAGTCACCAAAGATAAAGCGAT
    C283A-AACTACGGTCGCGGTCCAGCAGCCAAAGCGAGAGTTCC
Electrophoresis mobility shift assay
    24 bp-ds-GA/GT (sense)CCTCTTGCGGGAACTCTCGCTTTG
    24 bp-ds-GA/GT (antisense)CAAAGCGAGAGTTCCCGCAAGAGG
    24 bp-ds-GsA/GsT (sense)CCTCTTGCGGGsAACTCTCGCTTTG
    24 bp-ds-GsA/GsT (antisense)CAAAGCGAGAGs TTCCCGCAAGAGG
  • a The lowercase boldface “s” indicates the phosphorothioate modification site. Underlining indicates the sequence of interest.