TABLE 2

Oligonucleotides used in this study

Oligonucleotide nameaSequence (5′–3′)bTarget/comment (reference)c
oVPL234GAGATACCACCAGGTCCTAAGGCAGAGAAACGACGTTTGTTGCTAAGCTCAGACAAAGGATTATGTTGGTCCATAAATTGTRecombineering oligonucleotide for L. lactis rpoB mutant
oVPL236TCAAACCACCAGGACCAAGCGCTGAAAGACGACGCTTTCTGCTTAATTCACCTAATGGGTTGGTTTGATCCATGAACTGGRecombineering oligonucleotide for L. reuteri rpoB mutant
oVPL329ATTCCTTGGACTTCATTTACTGGGTTTAACRev, for pJP028 insertion screening
oVPL362TTGATATGCCTCCTAAATTTTTATCTAAAGRev, for pJP028 insertion screening
oVPL363TAATATGAGATAATGCCGACTGTACFwd, for pJP028 insertion screening
oVPL736TGAATGAGTGAGTCAACTTGFwd, amplified pMutL of L. reuteri
oVPL1199ATGTTATCGAAGAATAATCGAAAGGFwd, amplified signal peptide on pJP028
oVPL1200TGTATTAGCAGAAGCATTCATCCRev, amplified signal peptide on pJP028
oVPL1286TGATCTTTGAACCAAAATTAGFwd, amplified pJP028 backbone
oVPL1348GTTCCAATTCAAAAAGTTCAAGATGFwd, amplified murine leptin from gBlock gene fragments, codon optimized for L. reuteri (77, 78)
oVPL1349ACATTCTGGACTAACATCTAATTGRev, amplified murine leptin from gBlock gene fragments, codon optimized for L. reuteri (77, 78)
oVPL1350TTCATGGGGATGAATGCTTCTGCTAATACAGTTCCAATTCAAAAAGTTCAAGATGATACTLCR bridging oligonucleotide for leptin insertion for pJP028:SP:leptin
oVPL1351TTACAACAATTAGATGTTAGTCCAGAATGTTGATCTTTGAACCAAAATTAGAAAACCAAGLCR bridging oligonucleotide for leptin insertion for pJP028:SP:leptin
oVPL1408AGAAAACCGACTGTAAAAAGTACAGRev, amplified backbone of pJP028 for promoter swap
oVPL1409AGAAAACCGACTGTAAAAAGTACAGTCGGCTGAATGAGTGAGTCAACTTGAATTATTTGCLCR bridging oligonucleotide for swapping in EF-Tu promoter in pJP028
oVPL1410GCAGCAGAAATTGAAATAAGGTGATATTTAATGTTATCGAAGAATAATCGAAAGGAACAALCR bridging oligonucleotide for swapping in EF-Tu promoter in pJP028
oVPL1447CGAATTAATAGAAAAACATTAGTCAAATACFwd, amplified EF-Tu promoter
oVPL1448TAATGAAAACCTCCTGATAATTTACAAGRev, amplified EF-Tu promoter
oVPL1670CGTTAAAATAGGAAAACCTTTGCTTAGGTCAAATCGCAAGCTTTATCCGAAAACAGATTTAGTACCTGTTCCTGTCCGATRecombineering oligonucleotide for the ΔthyA mutant, introducing Y38*, Q39S, and M40L; bold nucleotides introduce 5 adjacent mismatches to the wild-type sequence
oVPL1671GCTATTTCTTAGATAAAGTGGCTGACFwd, for screening of the ΔthyA mutant (Y38*, Q39S, and M40L)
oVPL1672TTTGCTTAGGTCAAATCGCAAGCTTRev, for screening of the ΔthyA mutant (Y38*, Q39S, and M40L)
oVPL1673AAAATTGGAACATGGTGTGACATGGARev, for screening of the ΔthyA mutant (Y38*, Q39S, and M40L)
oVPl1725TTAAACTGCTACGGGAGCCTTGRev, amplified pMutL-ThyA
oVPL1810ATGGTTCCAATTCAAAAAGTTCAFwd, amplified leptin and added ATG start codon (bold)
oVPL2112ATCTTTATAATCACCATCGTGATCTTTATAATCACATTCTGGACTAACATCTAATTGRev, amplified leptin and added 3×FLAG tag (bold) to CTD of leptin
oVPL2113CACGATATTGATTATAAAGATGATGATGATAAATGATCTTTGAACCAAAATTAGFwd, amplified pJP028 backbone and added 3×FLAG (bold) to CTD of leptin
oVPL2351TAATCTCGCTTTGATTGTTCTATCGRev, amplified pJP028 backbone omitting Cmr cassette
oVPL2352AAGGAAGATAAATCCCATAAGGGCGFwd, amplified pJP028 backbone omitting Cmr cassette
  • a oVPL, van Pijkeren Laboratory primer identification number.

  • b Boldface nucleotides were added to the primer (for example, as a start codon, stop codon, FLAG tag).

  • c Fwd, forward primer; Rev, reverse primer; rpoB, β subunit of RNA polymerase, homolog of LAR_1402 in L. reuteri JCM1112; thyA, thymidylate synthase, homolog of LAR_0739 in L. reuteri JCM1112; LCR, ligation cycle reaction; CTD, C-terminal domain; Cmr, chloramphenicol resistant. An asterisk (*) indicates a stop codon. The locus tags listed can be found at https://www.ncbi.nlm.nih.gov.