TABLE 3

List of primers used in this study and their sequences

Sequence no.Name of primerPrimer sequenceNo. of bases
116S rRNA-8FGGATCCAGACTTTGATYMTGGCTCAG26
216S rRNA-907RCCGTCAATTCMTTTGAGTTT20
316S rRNA 341FCCTACGGGAGGCAGCAG17
416S rRNA-341F-GCCGCCCGCCGCGCGCGGCGGGCGGGGCGGG
GGCACGGGGGGCCTACGGGAGGCAGCAG
57
516S rRNA 518RATTACCGCGGCTGCTGG17
6Weissella FCTGAGGAATTGCTTTGGAAACTGGATG27
7Weissella RAAACCCTCAAACACCTAGCACTCATCG27
8Streptococcus FCTGAAGTTAAAGGCTGTGGCTCAACC26
9Streptococcus RGGATCCAACACCTAGCACTCATCGTT26
10Enterococcus FTCTAGAGATAGAGCTTCCCCTTCGGG26
11Enterococcus RGACTTCGCGACTCGTTGTACTTCCC25
12Lactococcus FGGAAGTTCCTTCGGGACACGGG22
13Lactococcus RATTAGCTAAACATCACTGTCTCGCGACTC29
14Lactobacillus FAGCAGTAGGGAATCTTCCA19
15Lactobacillus RCGCCACTGGTGTTCYTCCATATA23
16Pantoea FCCGATAGAGGGGGATAACCACTGG24
17Pantoea RCCGCACCGCCTTCCTCCC18