TABLE 1

Primers used for pyrosequencinga

SourceSample no.Forward primerReverse primer
Food, day 0Vial 1CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCMTGGCTCAGCTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT
Vial 2CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCMTGGCTCAG
Vial 3CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCMTGGCTCAG
Vial 4CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCMTGGCTCAG
Vial 5CGTATCGCCTCCCTCGCGCCATCAGTGTACTACTCAGAGTTTGATCMTGGCTCAG
Vial 6CGTATCGCCTCCCTCGCGCCATCAGACGACTACAGAGAGTTTGATCMTGGCTCAG
Food, day 16Vial 1CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCMTGGCTCAG
Vial 2CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCMTGGCTCAG
Vial 3CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCMTGGCTCAG
Vial 4CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG
Vial 5CGTATCGCCTCCCTCGCGCCATCAGTACGAGTATGAGAGTTTGATCMTGGCTCAG
Vial 6CGTATCGCCTCCCTCGCGCCATCAGTACTCTCGTGAGAGTTTGATCMTGGCTCAG
DrosophilaEggsCGTATCGCCTCCCTCGCGCCATCAGTCGTCGCTCGAGAGTTTGATCMTGGCTCAG
Vial 1CGTATCGCCTCCCTCGCGCCATCAGTCACGTACTAAGAGTTTGATCMTGGCTCAG
Vial 2CGTATCGCCTCCCTCGCGCCATCAGCGTCTAGTACAGAGTTTGATCMTGGCTCAG
Vial 3CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCMTGGCTCAG
Vial 4CGTATCGCCTCCCTCGCGCCATCAGATACGACGTAAGAGTTTGATCMTGGCTCAG
EnvironmentSample 1CGTATCGCCTCCCTCGCGCCATCAGACTACTATGTAGAGTTTGATCMTGGCTCAG
Sample 2CGTATCGCCTCCCTCGCGCCATCAGACGCGAGTATAGAGTTTGATCMTGGCTCAG
Reagent-only controlCGTATCGCCTCCCTCGCGCCATCAGACATACGCGTAGAGTTTGATCMTGGCTCAG
  • a The general primers PrimerA_MID_27F and PrimerB_338R were tagged with different MIDs to produce the indicated primers.