TABLE 2

Primers used for qPCR

TargetOrientationPrimer sequence (5′–3′)EfficiencyTma
Acetobacter pomorumbForwardCTAGATGTTGGGTGACTTAGTCA1.7954.6
ReverseCGGGAAACAAACATCTCTGCTTG
Acetobacter tropicalisForwardGGACAACTTAGTTGTTCAGTGTC1.8355.9
ReverseGGACACAGCCTACACATACAAG
Lactobacillus brevisForwardGACGTGCTTGCACTGATTTC1.9854.2
ReverseCCGAAGCCACCTTTCAAAC
Lactobacillus plantarumbForwardCGAACGAACTCTGGTATTGATTG1.9356.8
ReverseACCATGCGGTCCAAGTTG
D. melanogaster GAPDHForwardTAAATTCGACTCGACTCACGGT1.9257.0
ReverseCTCCACCACATACTCGGCTC
General 16S rRNA (341F + 534R)ForwardCCTACGGGAGGCAGCAG1.9655.2
ReverseATTACCGCGGCTGCTGG
  • a The optimal annealing temperature was determined via gradient qPCR in order to achieve the highest primer efficiency.

  • b The Ribosomal Database Project (46) probe match indicated that the A. pomorum primers may also amplify strains of the closely related species A. pasteurianus and the L. plantarum primers may also amplify strains of the closely related L. pentosus.