TABLE 1

PCR primer sequences and predicted product lengths

Target mRNA (purpose)Primer sequence (5′-3′)aProduct size (bp)GenBank accession no.
SenseAntisense
AvBD2 (RT-PCR and qPCR)ACCATGAGGATCCTTTACCTGCTTATGCATTCCAAGGCCATTTG198KF951417
AvBD7 (RT-PCR and qPCR)ACCATGAGGATCCTTTACCTGCGAGGTGCTTGAGACATTGTTGTAGC312KF951416
AvBD10 (RT-PCR)GGATCCATGAAGATCCTCTGCCTGCTCTTCGAATTCCTGCGCCGGAATCTTGGCACAGC216KF951415
AvBD10 (qPCR)GGTTCTGCAGATCCTATTTTTCCCCATCTCCTGCTCAAAATCCA147KF951415
TLR2 (qPCR)GATTGTGGACAACATCATTGACTCAGAGCTGCT TTCAAGTTTTCCC294XM_005500842
TLR3 (qPCR)TCAGTACATTTGTAACACCCCGCCGGCGTCATAATCAAACACTCC256XM_005500210
TLR5 (qPCR)CCTTGTGCTTTGAGGAACGAGACACCCATCTTTGAGAAACTGCC124XM_005511337
TLR7 (qPCR)TTCTGGCCACAGATGTGACCCCTTCAACTTGGCAGTGCAG219XM_005512700
TLR15 (qPCR)GTTCTCTCTCCCAGTTTTGTAAATAGCGTGGTTCATTGGTTGTTTTTAGGAC262KR018385
iNOS (qPCR)GAACAGCCAGCTCATCCGATACCCAAGCTCAATGCACAACTT103XM_005503254
β-Actin (qPCR)AGGCTACAGCTTCACCACCACCCATCTCCTGCTCAAAATCCA95AB618546
AvBD2 (protein expression)GAATTCATGCCTCAGCGGGAGATGTCTCGAGTTATGCATTCCAAGGCCA141KF951417
AvBD7 (protein expression)GAATTCATGCGTTACATTCCTGGGCGCTCGAGTCAGCCCCGTCTCCACC156KF951416
AvBD10 (protein expression)GGTACCATGCCTATTTTTCCTGACACCGAAGCTTTTAGAATTCCTGCGCCGG159KF951415
  • a Sequences of the corresponding restriction sites are underlined.