TABLE 1

Multiplexing scheme for primer pairs in pools

PoolLocusDiscriminative for (polymorphic):Diagnostic for (monomorphic)a:Primer 1Primer 2
LabelbSequenceLabelSequence
1Xo_G06X. oryzae pv. oryzae Asia, X. oryzae pv. oryzae Africa, and X. oryzae pv. oryzicolaVICGCAGACGGATGGGCGTTGGCTCGCCGGCACTCTCCT
Xo_G07NEDCAGGGCGAACGCGATGAGGCTCCATGGTGCCGGAGA
Xo_G58PETCAACGAGGTGCCCGGCAAGGAGCGCGCACATCATCG
Xo_G81GTGCCGTCTCCCGACGCT6-FAMGCCATCGCTACGCTGCGG
2Xo_G2553X. oryzae pv. oryzae Asia and X. oryzae pv. oryzae-AfricaX. oryzae pv. oryzicola (372)GCTGGCGGTGACCACCAC6-FAMGTCCAGCAGGTGCTCGCG
Xo_G88X. oryzae pv. oryzicola (312)VICCTCACTGCGGCGGTGTTGTAAGCTGCGCAAGGCGCG
Xo_G44PETGCCGTGCTTCCGTCTGCACCGCATCCATCGCGACAG
Xo_G62X. oryzae pv. oryzicola (141)GCTTCGCCGACCACGTGANEDACGACAAGCAGCGCCTGC
3Xo_G55X. oryzae pv. oryzae Africa and X. oryzae pv. oryzicolaX. oryzae pv. oryzae-As (294)VICACCCGGCAACTCGCAACCGGCACGAGCAAGCGGCAT
Xo_G59X. oryzae pv. oryzae-As (108)PETTCATTGCGTCACCCATCGGGGCGGGCGCTATCAACTGTCC
Xo_G60X. oryzae pv. oryzae-As (197, 185)GTTGCCGCCGCCGGTAC6-FAMCGGCGTCTTGCCAACCCT
Xo_G67X. oryzae pv. oryzae-As (322)NEDGCTTGGCGGGTCACATCGTGGATCGACGCCGGACTG
4Xo_G09X. oryzae pv. oryzae Asia and X. oryzae pv. oryzicolaX. oryzae pv. oryzae-Af (133)CCGCGATAGGCCGAGGTC6-FAMTGGCCTATCTGGCAGCGC
Xo_G15X. oryzae pv. oryzae-Af (137)CGCAACGATGTGCTGGCGVICCGCAATCGCTTCGAACGC
Xo_G80X. oryzae pv. oryzae-Af (346)PETACGGATGGCGTTGGCCAGCGGCATGATCCTGGGCG
Xo_G83X. oryzae pv. oryzae-Af (422)NEDCACCCGGCCGGCAATATCTGCACCACCACGTTGGCG
  • a Numbers in parentheses indicate predicted sizes of PCR amplicons (in base pairs) based on the analysis of 10 genome sequences.

  • b The following fluorescent labels of PCR primers were used (excitation/emission wavelengths in parentheses): VIC (535/555 nm), NED (550/570 nm), PET (570/590 nm), and 6-FAM (495/515 nm).