TABLE 1

Primers and probes used for conventional or quantitative PCR in this study

Primer specificity and primer nameaSequence (5′ to 3′)bProduct size (bp)Annealing temp (°C)Final primer concn (nM)TargetReference
Universal bacteria (conventional PCR)
    GM5-FCCTACGGGAGGCAGCAG55055400rrnS gene19
    907-RCCGTCAATTCCTTTGAGTTT400
Universal bacteria
    BACT1369FCGGTGAATACGTTCYCGG12359300rrnS gene20
    PROK1492RGGWTACCTTGTTACGACTT300
    TM1389FHEX-CTTGTACACACCGCCCGTC-BHQI300
strA
    strA-FTATGGTTGTTTGCCATGGTG14962400Streptomycin15
    strA-RTTCTCTTCGGCGTTAGCAAT400Phosphotransferase A
strB
    strB-FATCGCTTTGCAGCTTTGTTT14361300Streptomycin21
    strB-RATGATGCAGATCGCCATGTA300Phosphotransferase B
    strB-PHEX-ATGCCTCGGAACTGCGT-BHQI200
sul1
    sul1-FGACTGCAGGCTGGTGGTTAT10564200Sulfamethazine resistance gene 116
    sul1-RGAAGAACCGCACAATCTCGT200
aadA
    aadA-FCAGCGCAATGACATTCTTGC29363200Aminoglycoside adenyltransferase A21
    aadA-RGTCGGCAGCGACA(C/T)CCTTCG200
    aadA-PHEX-TGGTAGGTCCAGCGGCGGAG-BHQI300
blaOXA-20
    blaOXA-20-FTGATGATTGTCGAAGCCAAA10060400Beta-lactamase, class D (oxacillinase)22
    blaOXA-20-RGCCTGTAGGCCACTCTACCC400
  • a F, forward primer; R, reverse primer; P, probe.

  • b HEX, 2′,4′,5′,7′-tetrachloro-6-carboxy-4,7-dichlorofluorescein succinimidyl ester; BHQI, black hole quencher 1.