TABLE 1

Primers used in this study

No.LabelSequence (5′–3′)aReference
Used to construct AEV
    1flaB_NheI-5′GCTAGC-MCS-CTGTCGCCTCTTGTGGCTTCThis work
    2aadA_PacI-3′TTAATTAATTATTTGCCGACTACCTTGGThis work
    3flgB_NheI-5′GCTAGC-MCS-TACCCGAGCTTCAAGGAAGAThis work
    4aphI_PacI-3′TTAATTAATTAGAAAAACTCATCGAGCTThis work
    5bbe02_XhoI-5′CTCGAGGGTCAAATAGAAGGAGTGGAGThis work
    6bbe02_NotI-3′GCGGCCGCGCATCGTCTTTACTATCTTTCAAATCCCTAGThis work
    7BmpBT_NheI-5′ACCCCCGCTAGCCTTTTTTGGCTGGCTATATTGCAGCCAAAAAAAGCTTTTCGCTTTTTTGGCTGGCTATATTGCAGCCAAAAAAAGCTTTTCGGGGCCCCATATGAAGCTTGGTACCGGGGGGThis work
    8BmpBT_KpnI-3′CCCCCCGGTACCAAGCTTCATATGGGGCCCCGAAAAGCTTTTTTTGGCTGCAATATAGCCAGCCAAAAAAGCGAAAAGCTTTTTTTGGCTGCAATATAGCCAGCCAAAAAAGGCTAGCGGGGGTThis work
Used to confirm transformants
    9Spec-FTCCGCGCTGTAGAAGTCACCATTG33
    10Spec-RCCGGCAGGCGCTCCATTG33
    11Kan-FTCAGACTAAACTGGCTGACG33
    12Kan-RAAACTCACCGAGGCAGTTCC33
    13ospC-FCATTAAGTGCAATATTAATGACTTThis work
    14ospC-RCTGCCACAACAGGGCTTGTAAGCTCThis work
    15Lp25-FGTGCACCTATTGGAAAGGTC33
    16Lp25-RGGGCATGTTGCACATACGTT33
    17bbe02_638-FAAAGACAAGTAATGTAATAGAGGThis work
    18bbe02_1478-RGGGGATTTGGTTTTAAGCTGThis work
    19bbe02_2121-RCAGACGCAATATCACTAAATTCCThis work
    20bbe03_FTTCTAGACCAAATAAGGCTTCCGG34
    21pncA_FCACCAAGGATTGGCATTGTAThis work
    22pncA_RATAAAGCTGAAGGCCCGTTTThis work
TaqMan primers and probes
    23ospC-qFACGGATTCTAATGCGGTTTTACTT56
    24ospC-qRCAATAGCTTTAGCAGCAATTTCATCT56
    25ospC-probeCTGTGAAAGAGGTTGAAGCGTTGCTGTCAT56
    26pncA-qFCAGTAATGAAATAATTTCTTTGATTAACCAAThis work
    27pncA-qRGCTTACATGATTTTTACAATGCCAAThis work
    28pncA-probeTTCAAAATTATTTCAAAAACATTATTGCCACCAAGGThis work
    29flaB-qFTCTTTTCTCTGGTGAGGGAGCT56
    30flaB-qRTCCTTCCTGTTGAACACCCTCT56
    31flaB-probeAAACTGCTCAGGCTGCACCGGTTC56
  • a Sequences in boldface indicate restriction enzyme sites included in the oligonucleotide. MCS in oligonucleotides 1 and 2 represents the multiple-cloning site sequence GGTACCGGATCCCCCGGGACGCGTATCGAT (for restriction enzymes KpnI, BamHI, SmaI, MluI, and ClaI [5′ to 3′]). The underlined sequences in oligonucleotides 7 and 8 indicate the ApaI site incorporated into the sequence of the transcriptional terminator of the bmpB locus.