TABLE 1

Primers used in this study

Gene locusGene nameProtein name (function)Primer name (nucleotide sequence)
XAC0004gyrBGyrB (DNA gyrase subunit B)F1472 (ACGAGTACAACCCGGACAAG)
R1585 (GCATCTGCCGGTAGAAGAAG)
XAC3649atpDATP-D (ATP synthase, beta subunit)F464 (CCGTCAACATGATGGAACTG)
R600 (CTTGTCCAGGACGTTGGAGT)
XAC4225xylAXylA (xylose isomerase)F367 (TACGAGAGCAACCTCAAGCA)
R490 (TCGAGGCACCATTCATGTAG)
XAC4226salRSalR (sal operon transcriptional repressor)F546 (AGCCAAAGAGATCACCGAAC)
R730 (GGCCGGATTTGTAGGTGTAA)
XAC4227agu67Agu67 (α-glucuronidase GH67)F444 (CAGCGATATCGGGGTGTTAT)
R600 (ATAGCCACGTTCCACCAGAC)
XAC4230xyn43EXyn43E (arabinofuranosidase GH43)F1050 (ACAGCCGATTCCTTACATCG)
R1154 (GTGTGATCGAAATCGTCGTG)
XAC4237tetRTetR (transcriptional regulator)F89 (CGACCGAGACCTACGAACAT)
R244 (CGGACAACAGCGCATATTTA)
XAC4249xyn10CXyn10C (endoxylanase GH10)F328 (ACACCGGAGTGGTTCTTCAC)
R494 (GAACGGTAACTGCCGTCTTC)
XAC4252xyn10BXyn10B (endoxylanase GH10)F40 (GAAACTCCGTTATCCGCTCA)
R158 (CTTGCCGTGGGCTGTAGG)
XAC4254xyn10AXyn10A (endoxylanase GH10)F134 (TTGCGCAGTACTGGAACAAG)
R284 (ACCATGACATGCATCTGGAA)
XAC4255exuTExuT (exuronate transporter)F794 (CCGCAGAACTGGCGTATATC)
R946 (GCAGCCAGAACAGGAAGAAC)
XAC4256cirATBDR (tonB-dependent receptor)F122 (ACCGACGTAGCATCCAGTTC)
R222 (ATTCATGTCCGGAAACTTGC)
XAC4258xyn43FXyn43F (β-xylosidase GH43)F803 (CCTACGGCCCGTTTACCTAT)
R921 (GAGCACGCTGTCGTGATAGA)