TABLE 2

Oligonucleotide primers and probes

Function and nameSequence (5′–3′ [modification])aTargetReference or source
Primers for plasmid construction
    capHis-pBUS1-FTGCAGCTAGCATATGATAAACCTCCTATTTTCCTTTCTTGTTTTCCATTATATATAATCCCCTGTATATTTTGCAAACTCTGGTACCACGCGTTGCGCTCACpBUS1This study
    capHis-pBUS1-RTTTATCATATGCTAGCTGCAGGAATTCTCTGACTAGTCGACCGAAAGCTTTGCTGGATCCGCATGCTCGAGAGGTTCTCATCACCATCACCATCACTAATCTAGAGCGGCCGCCACCGpBUS1This study
    pBUS1-oriL-FAATGTTGTACAGAAAACCTCTGACACATGCAGpBUS1, pBUS1-Pcap, pBJW13This study
    pBUS1-oriL-RAGTTAAGATCTAGGATCAATTTTGAACTCTCTCCpBUS1, pBUS1-Pcap, pBJW13This study
    oriL-BsrGI-FTGAATTGTACACTTCCAAGTAAAGTATAACACACpUB110This study
    oriL-BglII-RTTAGAAGATCTGCGATTGCTGAATAAAAGATACGpUB110This study
    pBUS1-BsrGI-FTTAGTTGTACAGGCCATATTGTTGTATAAGTGATGpBUS1, pBUS1-Pcap, pBJW13This study
    pBlueScript-BglII-RAGTTAAGATCTATGACCAAAATCCCTTAACGTGpBUS1, pBUS1-Pcap, pBJW13This study
    pT181-BglII-FAGATAAGATCTATAGAACATGCATTTATGCCGAGpVPF5This study
    pT181-BsrGI-RTAATATGTACACTATTTCCAAAATTTAAATTCATGpVPF5This study
    mut-repC-FAAAGCTCCACAGAAATTCCAGAACAAAATATAAGAATTTGpTSSC, pTSSC-PcapThis study
    mut-repC-RAATTTCTGTGGAGCTTTCCCCATTCTTCTTCATCpTSSC, pTSSC-PcapThis study
Primers and probes for qPCR
    nuc263-FAAAGCGATTGATGGTGATACGGTTnuc38
    nuc355-RTGCTTTGTTTCAGGTGTATCAACCAnuc38
    nuc294-PATGTACAAAGGTCAACCAATGACATTCAGA (Cy5, BHQ2)nuc38
    qPCR-tetL-FGGCTTTCGTTCACCAAAACAGTtet(L)This study
    qPCR-tetL-RTGGTAAAGTTAAGCAAACTCATTCCAtet(L)This study
    FAM-tetL-TAMRATTGTTTCAAGTAGCTTGAAACAGCAGGAAGCTG (FAM, TAMRA)tet(L)This study
  • a Bases binding to the template are underlined. Restriction sites used for cloning are in boldface italics. Complementary 5′ ends of cloning and mutagenesis primers are in italics. In mutagenesis primers, mismatched bases are in boldface. Cy5, cyanine fluorescein 5; BHQ2, black hole quencher 2; FAM, 6-carboxyfluorescein; TAMRA, tetramethylrhodamine.