TABLE 1

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerCharacteristics or sequence (5′→3′)aSource or reference
Strains
    E. coli
        HI-Control 10GmcrA Δ(mrr-hsdRMS-mcrBC) endA1 recA1 ϕ80dlacZΔM15 ΔlacX74 araD139 Δ(ara leu)7697 galU galK rpsL (Strr) nupG λ tonA Mini-F lacIq1 (Gentr)Lucigen
    B. subtilis
        1A751his nprR2 nprE18 ΔaprA3 ΔeglS102 ΔbglT bglSRV82
        AW0091A751 amyE::(Pgrac.UPmod::hasSE:tuaD, Neor)Our lab
        AW001-21A751 lacA::(cas9, tracrRNA, Ermr)This work
        AW002-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::ugtP-gRNA.P395T, ParaE::mazF, Spcr) ΔugtPThis work
        AW003-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(ugtP-CRISPRa.P395T, ParaE::mazF, Spcr) ΔugtPThis work
        AW004-21A751 lacA::(cas9, tracrRNA, Ermr) amyE::Pgrac::hasSE:tuaD thrC::(PxylA.SphI+1::amyE-gRNA.P636T, ParaE::mazF, Spcr)This work
        AW005-21A751 lacA::(cas9, tracrRNA, Ermr) amyE::Pgrac::hasSE:tuaD thrC+This work
        AW006-21A751 lacA::(cas9, tracrRNA, Ermr) amyE::Pgrac::ΔhasSE:tuaD thrC::(PxylA.SphI+1::hasSE-gRNA.P394T, ParaE::mazF, Spcr)This work
        AW007-21A751 lacA::(cas9, tracrRNA, Ermr) amyE::Pgrac::ΔhasSE:tuaD thrC+This work
        AW008-21A751 lacA::(cas9, tracrRNA, Ermr) amyE::Pgrac::ΔhasSE:tuaD thrC::(PxylA.SphI+1::ugtP-gRNA.P395T, ParaE::mazF, Spcr) ΔugtPThis work
        AW009-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::amyE-gRNA.P636T, PxylA.SphI+1::ugtP-gRNA.P395T, ParaE::mazF, Spcr) ΔamyE, ΔugtPThis work
        AW010-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::amyE-gRNA.P636T, ParaE::mazF, Spcr) ΔamyEThis work
        AW011-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::amyE-gRNA.P25NT, ParaE::mazF, Spcr) ΔamyEThis work
        AW012-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::amyE-gRNA.P330T, ParaE::mazF, Spcr) ΔamyEThis work
        AW013-21A751 lacA::(cas9, tracrRNA, Ermr) thrC::(PxylA.SphI+1::amyE-gRNA.P1344T, ParaE::mazF, Spcr) ΔamyEThis work
        AW014-21A751 amyE::(Pgrac.UPmod::hasSE:tuaD, Neor) lacA::(PxylA, Bm::dcas9, xylR, Ermr)This work
        AW015-21A751 amyE::(Pgrac.UPmod::hasSE:tuaD, Neor) lacA::(PxylA, Bm::dcas9, xylR, Ermr) wprA::(PxylA.SphI+1::lacZ-gRNA.P28NT)This work
        AW016-21A751 amyE::(Pgrac.UPmod::hasSE:tuaD, Neor) lacA::(PxylA, Bm::dcas9, xylR, Ermr), wprA::(PxylA.SphI+1::lacZ-gRNA.P28NT) ugtP::(lacI, Pgrac::lacZ, Spcr)This work
Plasmids
    pIEFBPRPspac::mazF lacI Ampr Spcr, B. subtilis autoevicting counterselectable bpr integration vector48
    pDG1731B. subtilis thrC integration vector53
    pAX01PxylA, Bm, xylR Ampr Ermr, B. subtilis lacA integration vector54
    pCRISPRE. coli plasmid for CRISPRa transcription9
    pCas9E. coli plasmid for expression of Cas99
    pgRNA-bacteriaE. coli plasmid for gRNA transcription29
    pdCas9-bacteriaE. coli plasmid for expression of dCas929
    pAW008Pgrac::hasSE:tuaD Neor, B. subtilis amyE integration vectorOur lab
    pAW016Pgrac::lacZ lacI Spcr Ermr, B. subtilis ugtP integration vectorOur lab
    pAW001-2Pspac::mazF lacI Spcr Ampr, B. subtilis autoevicting counterselectable thrC integration vectorThis work
    pAW002-2Pspac::mazF lacI Spcr Ermr, B. subtilis autoevicting counterselectable thrC integration vectorThis work
    pAW003-2PxylA,Bm::mazF xylR Spcr Ermr, B. subtilis autoevicting counterselectable thrC integration vectorThis work
    pAW004-2ParaE::mazF araR Spcr Ermr, B. subtilis autoevicting counterselectable thrC integration vectorThis work
    pAW005-2PxylA.SphI+1 ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW006-2PxylA.SphI+1::ugtP-gRNA.P395T ParaE::mazF, araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW007-2PxylA.SphI+1::amyE-gRNA.P25NT ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW008-2PxylA.SphI+1::amyE-gRNA.P330T ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW009-2PxylA.SphI+1::amyE-gRNA.P636T ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW010-2PxylA.SphI+1::amyE-gRNA.P1344T ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW011-2PxylA.SphI+1::hasSE-gRNA.P394T ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW012-2CRISPRa, ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW013-2ugtP-CRISPRa.P395T, ParaE::mazF araR Spcr Ermr, B. subtilis counterselectable thrC integration vectorThis work
    pAW014-2(BglII) PxylA.SphI+1::ugtP-gRNA.P395T (NcoI) ParaE::mazF araR Spcr Ermr, B. subtilis multi-gRNA counterselectable thrC integration vectorThis work
    pAW015-2(BglII) PxylA.SphI+1::amyE-gRNA.P636T PxylA.SphI+1::ugtP-gRNA.P395T (NcoI) ParaE::mazF araR Spcr Ermr, B. subtilis multi-gRNA counterselectable thrC integration vectorThis work
    pAW016-2cas9, tracrRNA, Ampr, Ermr, B. subtilis lacA integration vectorThis work
    pAW017-2PxylA.SphI+1 ParaE::mazF araR Spcr Ermr, B. subtilis autoevicting counterselectable wprA integration vectorThis work
    pAW018-2PxylA.SphI+1::lacZ--gRNA.P28NT ParaE::mazF araR Spcr Ermr, B. subtilis autoevicting counterselectable wprA integration vectorThis work
    pAW019-2PxylA, Bm::dcas9 xylR Ampr Ermr, B. subtilis lacA integration vectorThis work
    pAW020-2Pgrac::hasSE:tuaD Ampr, ET for insertion of the HA biosynthetic operon into the amyE locus at amyE.P636TThis work
    pAW021-2hasSE-ET-1330bp-P394T Ampr, editing template for KO of hasSE at hasSE. P394TThis work
    pAW022-2amyE-ET-1330bp-P636T Ampr, editing template for KO of amyE at amyE.P636TThis work
Primers
    P1TCTACTTTGACCTGCAGGAAGTCATGTAAAAGATGAGGTTGGTTCATTCTC
    P2CAGATTGAGCTAGCGAAGGCAGCAGTTTTTTGGCC
    P3GTGACTGACCCGGGGGCGCGCCCTCGAGGCCTTCCGAAAATGC
    P4GTCACTGAACTAGTACCGGTAATTCCGGCGACTGTTTCTGTTTCAG
    P5CTCTACTTGAGCTCTAAAGCCTGGGGTGCCTAATGA
    P6GCTAAAGAGGTCCCTAGAAGCGCTAAGGATCTAGGTGAAGATCCTTTTTGATAA
    P7AGCGCTTCTAGGGACCTCTTTAGCTCCTTG
    P8CTACTTTGAGCCGGCTGAAGCATTTATCAGGGTTATTGTCTCATG
    P9CATACCTGCTTCCTCCTTAAGATCTCATTTCCCCCTTTGATTTTTAGAT
    P10CTCTATGACAATTGGCTCCTAACTTATAGGGGTAACACTTAA
    P11CAGATTGAGGATCCCTACCCAATCAGTACGTTAATTTTGGC
    P12AGATCTTAAGGAGGAAGCAGGTATGGTAAGC
    P13CATACCTGCTTCCTCCTTAAGATCTATGTTGAGTAAAGCGTTTTCATTTAAACCTTC
    P14CACTTTGAGAATTCTTATTCATTCAGTTTTCGTGCGGACTG
    P15GTCATTGAGCTAGCCATAAAAAACTAAAAAAAATATTGA
    P16GACATTGGATCCTGACATCAGTTACAGCATGCATCTTATATAACCTCGTCAGTATTT
    P17TATGATGCATGCAAGGAAAAACTGCTGGAGATGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P18TATGATGCATGCAGCGAATAACGGCAGTAAAGGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P19TATGATGCATGCCAGCCGACATCGTATCAAATGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P20TATGATGCATGCGCATTGAATGACGGGGCAGAGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P21TATGATGCATGCGGTTCATTTCAAGTGAACGAGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P22TATGATGCATGCCAAGCAATGTCATTGTTCATGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P23GCTCATGAGGATCCAAAAAAAGCACCGACTCGGT
    P24GAGACTTGGCTAGCTATTTCTTAATAACTAAAAATATGGTATAATACTC
    P25CAGATTGAGGATCCATGAGTTCAACTCAAC
    P26AAACAGATTACGTGAAGGAAAAACTGCTGGAGATG
    P27AAAACATCTCCAGCAGTTTTTCCTTCACGTAATCT
    P28GGAACTGCTAGCTGAATCATACAGATCTCATAAAAAACTAAAAAAAATATTGAAAATACT
    P29TTAACGTACTGATTGGGTAGCCATGGAAAAAAAGCACCGACTCGGT
    P30CCATGGCTACCCAATCAGTACGTTAATTTTGG
    P31GCTCATGAGGATCCTAAGGAGGAAGCAGGTATGG
    P32GCTATTGACCATGGAAAAAAAGCACCGACTCGGT
    P33GCTCATGAGGATCCAAAAAAAGCACCGA
    P34GTGTTAGATCTAGATAATGCGGTAGTTTATCACAGTTAAATTGC
    P35CTAAGATATCTAGATCAGTCACCTCCTAGCTGACTCAAATC
    P36GCTATTGACCTGCAGGTCGTGATGAGCAGCTGAGCC
    P37AGTATTTTCAATATTTTTTTTAGTTTTTTATGGCTAGCCAGGCTCATATTTCACATCCGC
    P38GCTAGCCATAAAAAACTAAAAAAAATATTGAAAATACTG
    P39GTGTTACCATGGCCTAGGTAGATTGAGCATGCCTTATTTTCATCTTATATAACCTCGTCA
    P40GACTTAGAGGCGCGCCGTCGCAGGCATTATTGCAGC
    P41GTGATTGAACCGGTTTCCTCTGACAGCTGTTTGAGTG
    P42GCATTAGCATGCGTCACGACGTTGTAAAACGAGTTTTAGAGCTAGAAATAGCAAGTTAAA
    P43GCTATTGAACTAGTAAAGGAGGTATCAAGTATGGATAAGAAATACTCAATAGGCTTAGCT
    P44GACATTGAAGATCTCCTGCAGGATAAAACGAAAGGCCCAGTCTTTC
    P45ACAAGAGGTTTGACGGCATGATTATC
    P46GATTTTTACATTGCTTGGATGTCATGATTATCACAGCAGTTTTTCCTTCACGTAATCTG
    P47TGATAATCATGACATCCAAGCAATGTAAAAATCACAGG
    P48CGCAGCTATGGATGATAAAGACTTG
    P49CCTACCTTCAACGTTATGACTG
    P50ACTTTTTTGTTTGGTGAAAGATTGTAC
    P51CTCAATCGGGAAACAGTTTTATCG
    P52ATCAATGCGCTCCACATAGC
    P53CATTGAGGTGAATTTACTTGAATACC
    P54GGAAGTGACTGACTCGAGA
    P55CGTTTACCAAGAAACTCCTTATGAATG
    P56TCAAAAGAAGGGCAAGTTCC
    P57ACATTCTTACCGCATCAAAGGAAGC
    P58CCATCTCCTTCGATAGCTGTGAAG
    P59GCTAGCCTGATCTCGACCATCGAATTCTTAGTGG
    P60CCAATGATTCGGATTTTGATAGCCGATGGT
    P61GTGATTGACCATGGTTGTTTGGAAAGCGAGGGAAGCGTTC
    P62GGTCTATTGCTAGCTGTGTGTTTCCATGTGTCCAGTTTGG
    P63GGCTTTTTGAACGATAGATTGCACCAG
    P64TCAAGCAATGTCATTGTTTAATAAGAGCTCGTCAATCAAGGAAAGCGTCATGCACAG
    P65GAGCTCTTATTAAACAATGACATTGCTTGATAGGTCACC
    P66CAATGATTCGGATTTTGATAGCCGATGG
    P67CGGGAGGAAGGTCATGAATAATCTGC
    P68GGCGGCATCAAATCGAAATTAAGTACTTTATCAATTCAATGCCCTGTCTAAGAACCG
    P69TGATAAAGTACTTAATTTCGATTTGATGCCGCCAAACATATAGA
    P70GGAAGAGAACCGCTTAAGCCCG
    P71CCATACATTCTTCGCTTGGCTG
    P72GTTACACCATCACTGTTCGTTCC
    P73TTGCCGCCAGCGGTATTCC
    P74TCCAGCGAATAACGGTTACTCGAGTTATTTGAATCGTTTTGCAAACATTCTTGACACTC
    P75TAACTCGAGTAACCGTTATTCGCTGGATTTTTATTGC
    P76AAGAGGCGTACTGCCTGAACG
    P77AAATCTGGTCGGAGATTGGGATGATAGC
    P78CTTGTTCAGTACCTAAGTAACGTCATTACTCGAGATACGATGTCGGCTGATACAGCC
    P79CTCGAGTAATGACGTTACTTAGGTACTGAACAAGAATTTAAAGAAATG
    P80TTCACTTGAAATGAACCCGCTCCA
    P81GCAACCGTTACTTAGGTACTGAACAAG
    P82GATCGTGCCTGTCAGTCATTAGGATCCCACTTGAAATGAACCCGCTCCAG
    P83GGATCCTAATGACTGACAGGCACGATCAATGCCAG
    P84GATGTTTTGACCGGTTGTGGCG
    P85CGAAGCGAAGGAAAATGGATGC
    P86GGTCAAAGCGTCTACTTCACAATGAG
    P87TGTATGAACGGTCTGGTCTTTGCC
    P88CAGGTATTCGCTGGTCACTTCGATG
    P89GAAACGGCAAAACGTTCTGG
    P90GTGTTGGGTTCACAATGTCG
    P138GGTTCACAACGATGGCAGCTC
    P139ACTGATCTGGATCCATGAGAACATTAAAAAACCTCATAACTGTTGTG
    P140GATTGATCTAGATTAGTGGTGATGATGGTGGTGTAATAATTTTTTACGTGTTCCCCAGTC
    P141ACAAGCTTCCTTTAGCACCAAAGAGAT
    P142AGAGGGATTTTTGACTCCGAAGTAAGTC
    P143ACGCAAATGCATAACTGCTTCCAACA
  • a Gene products: amyE, α-amylase; lacA (ganA), β-galactosidase; cas9, CRISPR-associated protein 9 (Cas9; Streptococcus pyogenes); mazF, endoribonuclease (Escherichia coli); thrC, threonine synthase; ugtP, UDP-glucose diacylglyceroltransferase; hasSE, hyaluronan synthase (Streptococcus equisimilis); tuaD, UDP-glucose 6-dehydrogenase; xylR, xylose operon repressor (Bacillus megaterium); wprA, cell wall-associated protease; dcas9, dead Cas9 (derived from S. pyogenes); lacZ, β-galactosidase (E. coli); lacI, lactose operon repressor (E. coli); bpr, bacillopeptidase F; araR, repressor of arabinose operons. Abbreviations: Neor, neomycin resistance cassette; Ermr, erythromycin resistance cassette; Spcr, spectinomycin resistance cassette; Ampr, ampicillin resistance cassette. In the primer sequences, restriction sites used for cloning are underlined, inserted restriction sites are italicized, and protospacer sequences are in bold.