TABLE 1

Oligonucleotides used in this study

NameSequencePurpose
s106315′-AATTCTTGTCGACGGCCAACGAGGCCCGGGCCAATAAGGCCTTTCTAGATTTGTACAGAASfiI sites in CRISPR vector
s106325′-TGTACAAATCTAGAAAGGCCTTATTGGCCCGGGCCTCGTTGGCCGTCGACAA
s106255′-AAAAAGTCGACGAGCGTTCACCGACAAACsgRNA in CRISPR vector
s106265′-AAAAGAATTCTTGACCGTGATTAGAGAATTGAGTAAAA
s107415′-CGAATTCGAGCTCGAGGTKanamycin resistance gene in CRISPR vector
s107425′-GCATGCCTGCAGTTGAAATCCCCTCAAAAACCC
s106295′-AAAAATGTACACCAATGTCATGACATTTTTATCInsertion of the 5′ end of cas9 in CRISPR vector
s106305′-AAAAATCTAGACTTCTTGGCTAGCTC
s107815′-AAAAACTGAGACCGATTCATTAATGCAGCTGInsertion of lacZ α in CRISPR vector
s107945′-TTTACGCGAGACCTCATTCGCCATTCAGGCTG
s106275′-AAAAACTTAAGTTAGGAGGCAAAAATGGATAAFusion of cas9 to PmanPA
s106285′-AAAAATGTACATCTAGACTTCTTGGCTAGCTCCCC
s106215′-AATTGAGTAAAATGTACCTACGCGAGACCGSemisynthetic sgRNA promoter
s106225′-GATCCGGTCTCGCGTAGGTACATTTTACTC
s106235′-AAAAGGATCCGGTCTCAGTTTTAGAGCTAGAAATAGCAAGPCR sgRNA of pCRISPomyces-2
s106245′-AAAAAGCTTTAGATAAAAAACGCCCGGCG
s107845′-TACGTGAAGATCAGGCTATCACTGTarget sequence for amyE deletion
s107855′-AAACCAGTGATAGCCTGATCTTCA
s107825′-AAGGCCAACGAGGCCATCGGCTTTTTTCTCAGPCR of homology template for amyE deletion
s107155′-AAGGCCATGTTGGCCTTGCCGAATTGTTTCTATAA
s107835′-AAGGCCTTATTGGCCTGAGGAAGCGTCTAAATCA
s107165′-AAGGCCAACATGGCCTCCGTGATGACGAAAAACA
s108935′-TACGTCCGGAGCTCCGATAAAAAATarget sequence for pulcherrimin gene deletion
s108945′-AAACTTTTTTATCGGAGCTCCGGA
s108895′-AAGGCCAACGAGGCCCAACAGGAAAAGCTTTCGPCR of homology template for pulcherrimin deletion
s108905′-AAGGCCATGTTGGCCCATGCGGGTGAGACTC
s108915′-AAGGCCAACATGGCCGCGGGCAGCTTTTTTTA
s108925′-AAGGCCTTATTGGCCTGGTACGCTGTCCCATG
s109625′-TACGTATTGATTCTCTTCAAGTAGTarget sequence for trpC2 gene repair
s109635′-AAACCTACTTGAAGAGAATCAATA
s109645′-AAGGCCAACGAGGCCGGTTTTTCATCACCGTG-3′PCR trpC wild-type sequence
s109655′-AAGGCCTTATTGGCCGTGACGGTTTAGATGA-3′
s110565′-CTACAGGTTGAAGAATCAAGAAGAATCGGAGCGGAT-3′Site-specific mutagenesis of trpC
s110575′-AGAATCAATAATAAAATCTTTTCTAAGTACAGG-3′