TABLE 2

Primers used in this study

PrimerSequence (5′ to 3′)aDescription
Datu3143.P1CGCGGATCCTTCGCCCATCAGATGCAGCDeletion of udh
Datu3143.P2CGCTGATCATCGCCATTCTTCCAAGCCTTTDeletion of udh
Datu3143.P3AAGAATGGCGATGATCAGCGGGATTGCAAGDeletion of udh
Datu3143.P4TTACGAGTCGACGGTAACGCGTCTGGCTGCDeletion of udh
Con3143.P1AGCACCGGAATGGATCGACConfirmation of udh deletion
Con3143.P2GCGGTTCAGGGCGTTCAGConfirmation of udh deletion
Com3143.P1ACGTCAGGTACCTCAAACTCATCCTTCATGATTGConstruction of udh complementation
Com3143.P2TCACTGTCTAGACGCTGATCATTCAGCTCTGConstruction of udh complementation
Datu313567.P1CGCGGATCCCTCGTGGATGGTGAAGCACDeletion of gaaPQM
Datu313567.P2GAGGAAAGCTTCCCGAGCTTGCAAACGAGDeletion of gaaPQM
Datu313567.P3AGCTCGGGAAGCTTTCCTCCTCCATTGTTGDeletion of gaaPQM
Datu313567.P4TTACGAGTCGACGCGATAATGGCAACACACTGDeletion of gaaPQM
Con313567.P1TGGACGATCTCATCATCTGCConfirmation of gaaPQM deletion
Con313567.P2ATGCAATGGCTCGGCATAGConfirmation of gaaPQM deletion
Com313567.P1TCACTGTCTAGAAAGGCTGCTTGCCGCTGConstruction of gaaPQM complementation
Com3137.P2CGTCAGGTACCGTCATCGGGCGCTGGTCConstruction of gaaPQM complementation
D3137.P1CAGTCAGGATCCTCATGCCGGAATTCATCTGCDeletion of gaaP
D3137.P2GGAAAGCATGTAACGCGCGGAAAACCGGDeletion of gaaP
D3137.P3CGCGCGTTACATGCTTTCCTCCTCCATTGDeletion of gaaP
Con3137.P1ATCGCCATCATCGCAAAGACConfirmation of gaaP deletion
Con313567.P2ATGCAATGGCTCGGCATAGConfirmation of gaaPQM deletion
3137RGS.P2CGCGGCTCGCATCACCATCACCATCACTAACGCGCGGAAAACCGGbRGS-6×His-tagged gaaP in situ replacement
3137RGS.P3ATGGTGATGCGAGCCGCGCTTGACCGCTTTCACCCGTbRGS-6×His-tagged gaaP in situ replacement
D3144.P1CTGACTGGATCCGGACAGCCACGCATCGTCDeletion of gaaR
D3144.P2GCAGTCTCACGCTTTTGTCATCTGTGTCGDeletion of gaaR
D3144.P3TGACAAAAGCGTGAGACTGCCCGCCTGAACDeletion of gaaR
D3144.P4GTCAGTCTCGAGCATCGAGGAGTGGCCGTTCDeletion of gaaR
Con3144.P1CAAATCCTTCAGGGCAATATCConfirmation of gaaR deletion
Con3144.P2CAGGGATGGTTTCAGTGAGConfirmation of gaaR deletion
2D3137RGS.P1CTGACTGGATCCTTGACCGCTTTCACCCGTConstruction of 240-bp in-frame deletion of gaaP
2D3137RGS.P2AACCGCGTCGTGCAGCAGTCGGATCTGTConstruction of 240-bp in-frame deletion of gaaP
2D3137RGS.P3CTGCTGCACGACGCGGTTCATGTCGATGConstruction of 240-bp in fra in-frame me deletion of gaaP
R148A.P1CGGTGCAGCGTCCTTCTACACCACCAAAAAGcConstruction of gaaP (R148A) mutation
R148A.P2GTAGAAGGACGCTGCACCGGAATCGTAAAAGGcConstruction of gaaP (R148A) mutation
R169A.P1TCTTAAAATCGCGGTGCAGCAGTCGGATCTGTcConstruction of gaaP (R169A) mutation
R169A.P2GCTGCACCGCGATTTTAAGACCCTTCAGGTCcConstruction of gaaP (R169A) mutation
R148Q.P1CGGTGCACAGTCCTTCTACACCACCAAAAAGcConstruction of gaaP (R148Q) mutation
R148Q.P2GTAGAAGGACTGTGCACCGGAATCGTAAAAGcConstruction of gaaP (R148Q) mutation
R169Q.P1TCTTAAAATCCAGGTGCAGCAGTCGGATCTGTcConstruction of gaaP (R169Q) mutation
R169Q.P2TGCTGCACCTGGATTTTAAGACCCTTCAGGTcConstruction of gaaP (R169Q) mutation
R148K.P1CGGTGCAAAGTCCTTCTACACCACCAAAAAGcConstruction of gaaP (R148K) mutation
R148K.P2TGTAGAAGGACTTTGCACCGGAATCGTAAAAGGcConstruction of gaaP (R148K) mutation
R169K.P1GTCTTAAAATCAAGGTGCAGCAGTCGGATCTGTcConstruction of gaaP (R169K) mutation
R169K.P2GCTGCACCTTGATTTTAAGACCCTTCAGGTCcConstruction of gaaP (R169K) mutation
3144HIS.P1GTCAGTCATATGACAAAAGCGACCACCTCGaaR overexpression in E. coli
3144HIS.P2GTCAGTCTCGAGGCGCGGCGCGCGCAACATGaaR overexpression in E. coli
P3137L.P1CGCACATCATGCTTGCAATCPutative promoter of gaaPQM; used for EMSA
P3137L.P2GTTCAAGCTGTCGCCGGTCPutative promoter of gaaPQM;used for EMSA
P3140F.P1AGCCGAGCGCCGTCTTGPutative promoter of kdgD; used for EMSA
P3140S.P2GGCGCTATTCTCAACGTCGPutative promoter of kdgD; used for EMSA
P31423L.P1GTTCACGGCCTGCCTGGTIntergenic region of kduI and udh; used for EMSA
P31423S.P2CGCCGCACCGGTAACAAGIntergenic region of kduI and udh; used for EMSA
P3144L.P1CGCCACCGGACCCGAATGPutative promoter of gaaR; used for EMSA
P3144L.P2CGGTTCGGAGGTGGTCGCPutative promoter of gaaR; used for EMSA
In3144.P1GTGTTTCCTCGCTGATCGAGgaaR internal DNA sequence; used as control in EMSA
In3144.P2GCTTCGGCGACCGCGATGgaaR internal DNA sequence; used as control in EMSA
D1450.P1AGTCATGAATTCGCCAAGCAGCTCGGCTGDeletion of hfq
D1450.P2GGAGCCTGAGGCGCCGCTTCTTTCTTTATDeletion of hfq
D1450.P3CGGCGCCTCAGGCTCCTTTAACGGTATCDeletion of hfq
D1450.P4AGACTGTCGACAGTTCAGATGCGCAAGATCGDeletion of hfq
Con1450.P1GCTCACCAATAACGACCAGConfirmation of hfq deletion
Con1450.P2AAGGTGGGTCCAGCTTCTGConfirmation of hfq deletion
Comhfq.P1AGTCAGGTACCGGATGGCAGCACGAAGConstruction of hfq complementation
Comhfq.P2ACTGCTCTAGAAATGTTCCGATTCAGGTCAGConstruction of hfq complementation
  • a Boldface bases indicate engineered restriction sites.

  • b Underlining indicates the added RGS-6×His tag before the stop codon of gaaP.

  • c Underlining indicates the mutated codon at R148 and R169 residues of GaaP.