TABLE 2

Primers

Function and primerPrimer sequence (5′–3′)eEfficiency (%)
ForwardReverse
Mutant constructiona
    bcsA deletionAGCCTGCGATGAGCGCCCTTTCCCGGTGGCTGCTTATCCCGTGTAGGCTGGAGCTGCTTCTTCATCGCATTATCATCATTGTTGAGCCTGAGCCATAACCCATATGAATATCCTCCTTAG
    STM1987 deletionTCAGGGGGAGTTGTATCAATAACCAGGAGTTACCAGGGTGGTGTAGGCTGGAGCTGCTTCACGAAGGGCCGGATGGCTGGCGCGAAGGAATGGACTATTTCATATGAAATCCTCCTTAG
    STM2123 deletionATTCCGCGACGTTACCGGCGATTCGGATAGAGTGGTAATGGTGTAGGCTGGAGCTGCTTCACTGCATATCTGGTATACCCACGGCTGGCAACCGTCAATGCATATGAATATCCTCCTTAG
    STM3375 deletionTTTCATACTGTTTATAACCGTCGGAGTTAACTCAAGGATGGTGTAGGCTGGAGCTGCTTCCGTTATTCTACGTGAAAACAAATTAAACGGCAGGTTAAACCATATGAATATCCTCCTTA
    STM3388 deletionCTGTTCTTTTCCTGCATAACCAATGAGCTAATGATACATGGTGTAGGCTGGAGCTGCTTCTGCCAAATGAACAACAGGCGGAAGAAGCCTGAGATTATTTCATATGAATATCCTCCTTAG
    STM3615 deletionCAATTTGCGCGTCAGCCGCTCGTTAACAATTAAACAGATGGTGTAGGCTGGAGCTGCTTCAAGTTTGAGCTGGCTCGCACAAGCGCGACCTTTTTTAACTCATATGAATATCCTCCTTAG
    STM4264 deletionTGCAGGGAAATAGGCTGAAAATGAGTCAAAGCACACGACGGTGTAGGCTGGAGCTGCTTCCACTCCCAGCGATTACCGTCACCGCCTGTAGGGCGTCTGCCATATGAATATCCTCCTTAG
Mutant confirmationb
    adrA confirmCATACTTCCTCCATGCGCCAGTAAATCCTGAAGCCC
    bcsA confirmGGAGCCTGCGATGAGCGCTAATCCTATTACCGCCGC
    csgB confirmCTATGTACGACCAGGTCCAACGGTATTAGCGTTGGG
    STM1283 confirmGGTAAACTAACGCATCCGATTTCTCACTCCTGGTGC
    STM1344 confirmTACGTCTGTTTCCGTCCGTAGACGGTTAATCACCGG
    STM1697 confirmTAAGATCAAGTGGAGTGGTTCTAACGCAACGGAAGG
    STM1703 confirmTTCTTTTCGGGCACCTGGTGCACAGGCTGTTCTCCC
    STM1987 confirmTGGTATCCCTTGATGAGGTTTGCGTAACGACGATCC
    STM2123 confirmGCGATTCGGATAGAGTGGAACCGTCAATGGATAGCG
    STM2410 confirmGCATTAAAGCAATGCCGGGTTTAATGCAGAAACCGG
    STM2503 confirmAAAGTCAGGTGGGATGCCTTGAGGAAGAAAGCTCGC
    STM2672 confirmGTATTAATGCTTGCACGGTTATGGGTTTGCTCCACG
    STM3375 confirmGTATGCCTGCTTCATTGCTTGCTGCAACAATCTGGC
    STM3388 confirmCTCGTCCTGTTCTTTTCCCCAAATGAACAACAGGCG
    STM3615 confirmACAGCCTCTCTTAATGCCAAGTTTGAGCTGGCTCGC
    STM4264 confirmAATGAGTCAAAGCACACGTATGTATCGCAGCAAACC
    STM4551 confirmATTCCGTGTATATCACCGATGGCAAGCGGTTTATGG
    wcaB confirmATGCTGGAAGACTTACGCAATATTCATGTGCTGACC
    wcaD confirmGTCAACAGATGCTGGAGGCGAAAGGCGACGGTAACG
    wzc confirmACTGAATGCAGAGCAGGGTATTTGGAATCTGACTGG
Complementationc
    Tn7A fragmentNNNGGGCCCTTACATTCACGCGGAAGCNNNCTCGAGAAAGGCCGTCTGTCGACG
    Tn7B fragmentNNNACTAGTTTTTGTGCGCTGTGACAGNNNAAGCTTAATTATGATGACTGGGCG
    Tn7compFor/RevCCGTAGAGTAAGTACAAATGTAGTACCAGGCAGAAGGCCGTTCAGCCACCATAGAGAAAGAACAGCGCCTGTCACAGCGC
    Tn7compA/BTTACATTCACGCGGAAGCAATTATGATGACTGGGCG
    adrA compNNNCCTAGGAAACAGTCAGTCAGCCCCNNNTCTAGATGGAAGAACGTGGCTTCC
    STM1987 compNNNCCTAGGTGAGAATGAGCTCGTGCCNNNTCTAGATTTGCGTAACGACGATCC
    STM3375 compNNNCCTAGGTCTAAGATCAACGCCTGCNNNTCTAGACGAGCAGACAAGCACACC
    STM3615 compNNNCCTAGGGTATGTTCGTTATTCCGCNNNTCTAGAACATGACAGAAATGCGCC
Real-time PCR analysisd
    rpoDGTGGATACCGTCTTATGGGATAGCCTTGCTCCTTAC91.4
    pykFGGAAGCCGTTTCTATCATTCGTTGTTGTAGTCCAGA84.1
    STM1987TTTACCTCTCAACTCTCCCTTTGCTCGATAAACCAT115.6
    wcaBAAGAATGTGCTGAATAATCTGATTTCATACCCGAACAG111.7
    wcaDAGGCTCATCTTCTTATTATCGTCTGACTACACCATCAATATG105.1
    wzcTTGGCATGATTAATAACCCAGATAGTTACGGGTAAT98.5
  • a Mutant construction primers were designed and used following the λRed recombinase method (22).

  • b Mutant confirmation primers were used to amplify across potential deletion-insertion sites and compare the resulting product sizes to that observed when using wild-type genomic DNA as the template.

  • c Complementation primers were used to create the Tn7 complementation vector and amplify genes of interest (as described in Materials and Methods).

  • d Real-time PCR primers were used to confirm microarray analysis results (as described in Materials and Methods).

  • e Underlining in sequences indicates restriction sites utilized in vector construction.