TABLE 1.

Oligonucleotide sequences used in this study

Orientation and primerSequence (5′-3′)aDestination vector
Forward
    PaMan5AEcoFTTTGAATTCCTCCCCCAAGCACAAGGTGpPiCZαA
    PaXyn11AEcoFTTTGAATTCCGTCCTTTCGACTTTCTCGpPiCZαA
    PaMan26AClaFTTTATCGATAAAGCCTTGTAAGCCTCGTGpPiCZαC
    PaAbf51AEcoFTTTTTTGAATTCATTGATTTGTTTGTCAAGTCpPiCZαA
    PaAbf62AEcoFTTGAATTCTCTTCCCTGCCAGCTGGGCpPiCZαA
Reverse
    PaMan5AXbaRTTTTCTAGACCCGCCGGGAGAGCATTGATAGpPiCZαA
    PaXyn11AXbaRTTTTCTAGACCGTGTGTCTGGACATAAATGTCpPiCZαA
    PaMan26AXbaRTTTTCTAGACCACTCCTCCACCCCTGAATCTCpPiCZαC
    PaAbf51AXbaRTTTTCTAGACCGTTACCCTTTCCCTTGCCCTTGpPiCZαA
    PaAbf62AXbaRTTTTCTAGACCACAAGCAGGGTTGTTGTGTGCGpPiCZαA
  • a The restriction sites added to insert genes into pPICZαA or pPICZαC are underlined.