Table 3.

U.S. Xanthomonas-specific PCR primers

PrimerForward sequenceReverse sequenceProduct length (bp)Start positiona
USX1GCGCCTGCACAACAATATCGTACTGCACCACCGTCTGC3094127617
USX2TCCTCAAAGTTTCCCAGTGCGGCGTTGGTAAGACGAAGTC3021625928
USX3ATGCAACACCTGCATTTACGCGACACAGAAAACAGGCTCA30611089
USX4TGGTGGCGAGCTTCTACTATGGTAGGTCGTCCCAGTTCAGC3272395182
USX5AGTCGCGCTGTTCTCTCAGTAAGCAACAGCAGACCACCAT3101221500
  • a Position of forward primer in assembly 1 of the sequence of strain X11-5A.