Table 1.

Primer sets used for diagnostic and quantitative PCR

Target organism(s)Target genePrimer nameNucleotide sequence (5′→3′)Product size (bp)Annealing temp (°C)PurposeSource or reference
StinkbugMitochondrial cytochrome oxidase I gene (COI)LCO1490GGTCAACAAATCATAAAGATATTGG65048Diagnostic PCR12
HCO2198TAAACTTCAGGGTGACCAAAAAATCA
Burkholderia symbiont16S rRNA geneBurk16SFTTTTGGACAATGGGGGCAAC75055Diagnostic PCR32
Burk16SRGCTCTTGCGTAGCAACTAAG
Burkholderia spp.dnaABurkDnaA-FGGCCTSGGCAAGACSCAYCT80069CloningThis study
BurkDnaA-RGTSGTRTGRTCGCGGCCGCC
Burkholderia symbiontdnaABSdnaA-FAGCGCGAGATCAGACGGTCGTCGAT15060Quantitative PCRThis study
BSdnaA-RTCCGGCAAGTCGCGCACGCA