Table 1.

Primer sequences used in this study

Gene targetPrimer nameaSequence (5′–3′)
cprA2cprA2-fAAGGCCAGTGGTCCAAGTTAAAGC
cprA2-rAAATCCGCCGTCGTCTTCATTGGT
cprA3cprA3-fAAGAAATGCGCCGAATTCCGTCTG
cprA3-rATCCAAATGCCGGCTGAATGGAAC
cprA4cprA4-fTGACCAATGGCTTGGTACCTCGAA
cprA4-rTAGCCATTCCCATGGCATCACTCA
cprA5cprA5-fTTAAAGCATCTCTGGTGAGCGTCG
cprA5-rACTTGGTAAGGAAATTCCGCGGTC
rpoBrpob-fTCCTGAAGGTCCCAACATCGGTTT
rpob-rATTTCTCTTCTTCGTCGGCGGTCA
  • a f, forward primer; r, reverse primer.