TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerDescription, relevant phenotype or genotype, or sequence (5′ to 3′)Source or reference
Strains
    E. coli DH10BF mcrA Δ(mrr-hsdRMS mcrBC) φ80dlacZΔM15 lacX74 deoR recA1 araD139 Δ(ara, leu)7697 galU galK ΔrpsL endA1 nupGGibco/BRL
    C. perfringens
        13Gangrene strainC. Duncan
        SM101Acute food poisoning strain32
        JGS4143Chicken necrotic enteritis strainJ. G. Songer
        AH1bglR::pAH4, from strain 13This study
        AH2bgaR::pAH6, from strain 13This study
        SM126pilC mutant derived from strain 1330
Plasmids
    pGEM-T EasyAmpicillin resistancePromega
    pSM240Contains cpe-gusA; chloramphenicol resistance9
    pAH1Mutated bgaR with PbgaL in pSM240This study
    pAH2pSM240 with bgaR and PbgaL upstream of cpe-gusAThis study
    pKRAH1Contains bgaR-PbgaL and polylinker; chloramphenicol resistanceThis study
    pSM300Suicide plasmid in C. perfringens; erythromycin resistance29
    pAH3Contains a fragment of strain 13 bglR in pGEM-T EasyThis study
    pAH4Contains a fragment of strain 13 bglR in pSM300This study
    pAH5Contains a fragment of strain 13 bgaR in pGEM-T EasyThis study
    pAH6Contains a fragment of strain 13 bgaR in pSM300This study
    pAH7Contains strain 13 bgaR and PbgaL in pGEM-T EasyThis study
    pSW4-YFPVector containing a low GC codon-optimized yfp gene23
    pAH11Contains yfp-pilB in pGEM-T EasyThis study
    pKRAH-YpKRAH1 with the yfp gene
    pKRAH-YBpKRAH1 with the yfp-pilB fusion gene
Primers
    OAH1GTTAACCTCGAGATGAAAAGTATTAGGGC
    OAH2GCAGTTCTGCAGTATCTTCATGGTATTC
    OAH5GGAGAGGTACCAGTTGAACATAAGGGAGG
    OAH6CATGGAGCTCTCTTATCTCTAGAAACTAATTC
    OAH13CCGAGCTCTTACCCCCCGGGATC
    OAH14CCGCGGTAAATAACAAAAAGGAGAACGCATAATGTCAAAAGGAG
    OAH36CACACGGAATGGATGAATTATATAAGATGAAATATACCATTAAAGAT ATAGATATGAAGC
    OAH37CTTCATATCTATATCTTTAATGGTATATTTCATCTTATATAATTCATCCATTCCGTGTGTAATTCC
    OAH38GAAGCGAGCTCTTTAAACCCAAACATCTAAC
    OKR055GAATCTAGAATCCGCGGTAGTCGACATCCATGGTTGAGCTCATGGATCCTAA
    OKR056AGCTTTAGGATCCATGAGCTCAACCATGGATGTCGACTACCGCGGAT TCTAGATTCTGCA
    OAH56GGTACCCAAGTTGAGTATGTGGCTTCTATTGATG
    OAH57GAGCTCTTCTGCTTAAGTTTACATAATCAGC