Table 2.

Cloning and sequencing primers for L. acidophilus NCFM chromosomal gusA3 insertions

Primer (ORF)Primer sequencea (5′-3′)Size of product (bp)
ForwardReverse
Cloning primers
    169upCAAGCGATCGACCAAGGTCAAGTTAATGCAAGGAATTCTAGCGTTAGTGCTAC692
    169dnCAAGGAATTCAGGCAGAGCGAAAGCTCTGCAAGGTCGACGACCGACGGTACTATTTATC603
    1462upCAAGGTCGACTCTCGTCTGTATATTCTAACCAAGGCGGCCGCCGAACGAAAATGTCCGGCCT623
    1462dnCAAGGCGGCCGCACCTTATTTATTTGATCTACGGCAAGCGATCGTCTATGAACGCAATATTCC752
    889upCAAGCGATCGATAGCGATTGTATTAGTAACCAAGGCGGCCGCACCGAGTACAATTTCAAC616
    889dnCAAGGCGGCCGCATTAATCGTGGTCAACATCCAAGGTCGACTTTACACGAATCAATCATC626
    645upCAAGCGATCGGATGTTGCTCAGGTAGATAGCAAGGCGGCCGCTCACTAAAGAGGTCGAGAGTATG624
    645dnCAAGGCGGCCGCCTATATGGTATTTTTATGTGCACTGGCACAAGGTCGACGAGTAAACATCGAGAAATTG613
    p892_Gus1CAAGGAATTCTAAGAAGGCTGAATTCTACCAAGGAATTCTGAGCACGATTATTTG1,864
    p892_Gus2CAAGGCGGCCGCTAAGAAGGCTGAATTCTACCAAGGCGGCCGCTGAGCACGATTATTTG1,864
Screening primers
    p935mcsTGAAATACCGCACAGATGACACAGGAAACAGCTATG
    169GTTGCTTCACTTACTAATGCTTATCCCTTTAGGATATTCAG
    1462GAATCCATGAGTCGAAATATCTTTAGGGTCAAAGACTAAGG
    889GTTGTTGTTCCTGTAGGTAAGATTGCCACACTTTGAAGAAGGTTCTTG
    645AGGCTAAATATTAATGATTTACCGAAGAGAACGAAATTTAAC
  • a Enzyme restriction sites are underlined.