Table 1.

Primers used in this study

PrimerSequence (5′ → 3′)Purpose
phesFCTCGAGATGGATTTACAAGCACAATTAGpheS amplification
phesRTTAATTGAATTGTTCTGTAAAACGGpheS amplification
phesmFGCTTTGGCTTAGGCCASite-directed mutation of pheS
phesmRCAAAACCAGAATATTCTTCAGAATTAACGSite-directed mutation of pheS
ldhF-bamHIGCCGGATCCCCGAGCAACAATAACldh promoter amplification
ldhRAACATCTCCTTATAATTTATTAAGldh promoter amplification
pheSF-ldhCTTAATAAATTATAAGGAGATGTTCTCGAGATGGATTTACAAGCACIFDC1 construction
ermF-pheSACAGAACAATTCAATTAAGAAGGAGTGATTACATGAACAAIFDC1 construction
ermR-hindIIIGCCAAGCTTGAAGCTGTCAGTAGTATACCIFDC1 construction
mphesF1TTAATTCTGAAGAATATTCTGGATTCGGGTTCGGGCTTGGACAGGAGAGAATGGCAATGTIFDC2 construction
mphesF2ACAGGAGAGAATGGCAATGTTAAGATACGGTATAAACGACATAAGGGGATTTTACCAGGGIFDC2 construction
mphesRCACTCCTTCCTAGTTAAACTGCTCAGTGAATCGACTATCTCCCTGGTAAAATCCCCTTATIFDC2 construction
phesR-molCCCGAATCCAGAATATTCTTCAGAATTAACGCIFDC2 construct
ermF-molACTGAGCAGTTTAACTAGGAAGGAGTGATTACATGAACAAIFDC2 construction
ldhFCCGAGCAACAATAACACTCIFDC2 amplification
ermRGAAGCTGTCAGTAGTATACCermAM and IFDC2 amplification
150upFTAAGATAGAAGTGGTTTCCCnlmA deletion
150upR-ldhGAGTGTTATTGTTGCTCGGTGCCTGTGTATTCATATGATnlmA deletion
150dnF-ermTATACTACTGACAGCTTCGATCTGTAGTTTTTCCACACnlmA deletion
150dnRCCACCACTGCTACTAACAACnlmA deletion
150upR-IFDCATATGATAAGTACCCCTTTnlmA deletion
150dnF-IFDAGGGGTACTTATCATATGTAAATGGAATGGAGAATTAATACnlmA deletion
423upFTCATCGTATTGAACGTGTTGnlmD deletion
423upR-ldhGAGTGTTATTGTTGCTCGGGCTTGTGTATTCATATGATAGnlmD deletion
423dnF-ermTATACTACTGACAGCTTCGTGCTGCTACTTTTTGTTGAnlmD deletion
423dnRTCATTTTGATGTCACCTCCAnlmD deletion
423upR-IFDTTCATGTTCACATATGATAGATACCTCTTTTCnlmD deletion
423dnF-IFDGAGGTATCTATCATATGTGAACATGAAAAATAGAAGATCCTnlmD deletion
1914upFCAATGTAGAAGTCTCAAGTAnlmC deletion
1914upR-ldhGAGTGTTATTGTTGCTCGGGTTCAAATGCTTGTGTATTCnlmC deletion
1914dnF-ermTATACTACTGACAGCTTCGCTCTTAATTCCTGTGGTTAGnlmC deletion
1914dnRCAATGATATTAGTTCTTATCCCnlmC deletion
1914upR-IFDAATTACTAAGATCCCATATGATAAATACCCCTTCnlmC deletion
1914dnF-IFDTTATCATATGGGATCTTAGTAATTTAATTTTTAAGGAGGCAGnlmC deletion
150pFGTGTAAAACTTCTATTAAACAGnlmA mutant verification
423pFTATGTTTGTAGTCAGTTGCGnlmD mutant verification
1914pFGAAAAAATCATGGATTTTCTTGnlmC mutant verification