TABLE 3.

Primers used to amplify and sequence the four MLST markers

MarkerPrimer sequence (5′-3′)Description and function
fimHCGTCGTCATAAAAGGAAAAAForward primer for both amplification and sequencing
GAACAAAACACAACCAATAGCReverse primer for both amplification and sequencing
CTCGCCAGACAATGTTTACTReverse primer for sequencing internal region
CATTCACTTCGCAGTTTTGForward primer for sequencing internal region
sseLAGGAAACAGAGCAAAATGAAForward primer for both amplification and sequencing
TAAATTCTTCGCAGAGCATCReverse primer for both amplification and sequencing
GGAGTTGAAAATCTTTGGTGReverse primer for sequencing internal region
TTTACCGAGAGAAAAGGTGAForward primer for sequencing internal region
CRISPR1GATGTAGTGCGGATAATGCTForward primer for both amplification and sequencing
GGTTTCTTTTCTTCCTGTTGReverse primer for both amplification and sequencinga
GATGATATGGCAACAGGTTTReverse primer for both amplification and sequencinga
TATTGACTGCGATGAGATGAReverse primer for both amplification and sequencingb
CRISPR2ACCAGCCATTACTGGTACACForward primer for both amplification and sequencing
ATTGTTGCGATTATGTTGGTReverse primer for both amplification and sequencing
  • a The two reverse primers (reverse 1 and reverse 2) of CRISPR1 were added together with the forward primer to amplify CRISPR1 in all serovars except Salmonella serovar Javiana.

  • b The reverse primer for SJ (Salmonella serovar Javiana) was needed for amplification and sequencing of CRISPR1 in Salmonella serovar Javiana isolates.