TABLE 2.

DNA sequences at insertion site of IS2

Strain or IS2Flanking sequencea (% G+C content)Left end-IS2-right endFlanking sequence (% G+C content)IS2 orientationb
E. coli MG1655ATTACAACTACGATCCCCATTATGGTCGTTATGAT
SPC35RMG-L1ATTACAACTACGATCCCCAT (40)TAGACTGGCCCCCTG . . . ATAGGGGCAAATCCACCCATTATGGTCGTTATGAT (40)+
SPC35RMG-M1ATCAAACCGTTAAAATGGGC (40)TAGACTGGCCCCCTG . . . ATAGGGGCAAATCCATGGGCGGTGTGAGCTTGTGG (65)+
SPC35RMG-S1GTTATGTTGAGGATGGATAT (35)TGGATTTGCCCCTAT . . . CAGGGGGCCAGTCTAGATATGATCAACGTAATACC (35)
SPC35RMG-S2TCGGCGACGCTCGATGAGAT (60)TGGATTTGCCCCTAT . . . CAGGGGGCCAGTCTAGAGATGAAGCAATACACCGT (45)
IS2AcACGAATAAACGCATAATTAC (30)TAGACTGGCCCCCTG . . . ATAGGGGCAAATCCAATTACCTATCAGGCAGTTTG (40)+
IS2DACATCATGGGACAAGAACCC (50)TGGATTTGCCCCTAT . . . CAGGGGGCCAGTCTAAACCCCAGAACTTACTTATG (40)
IS2EdCACTGGATGACGAACTGGCC (60)Truncated IS2 . . . ATAGGGGCAAATCCACAGGTGAACTACGCTCCTCT (55)+
IS2FAACAAATCCGCATTCGTGGC (50)TGGATTTGCCCCTAT . . . CAGGGGGCCAGTCTAGTGGCGAAGCATCCTCCCGT (65)
IS2HAGTAAATTCCAATTGTTTAT (20)TGGATTTGCCCCTAT . . . CAGGGGGCCAGTCTAAACTTGCTCTTTTCTTCTGG (40)
IS2ITATTGTTCATTATCCGTTAT (25)TAGACTGGCCCCCTG . . . ATAGGGGCAAATCCAGTTATCATCATTGGTTGTGC (40)+
IS2KAGGGATTTGATGGTCCCTTG (50)TAGACTGGCCCCCTG . . . ATAGGGGCAAATCCACCTTGTGCTGATATGAATAC (40)+
  • a The 5-bp flanking sequence duplications are underlined. Note that IS2E and IS2H do not have these duplication sequences.

  • b +, IS2 inserted in the same orientation as the direction of btuB transcription; −, IS2 inserted in the opposite orientation as the direction of btuB transcription.

  • c Sequences for IS2 elements have been retrieved from GenBank accession no. U00096.

  • d IS2E is a truncated element that does not contain an insC (orfA) gene.