TABLE 1.

Genes and primers selected for RT-qPCR

Gene function/protein encodedaGenePrimerSequence (5′→3′)
Oxidative stress response genes
    Peroxide-sensing regulatorperRForwardTTCAATCTCTTTAGCGACGG
ReverseCACATTTGGCGCAAACAACA
    Flavodoxin IfldAForwardTCCACCAAGACTAAGCCCTG
ReverseCAGAAGGAGCGGCTAATACAA
    Iron-binding proteindpsForwardCCACTAATGTTAATATGCGTTCC
ReverseTGTGCTTGATAATCTTGCGACAA
    Superoxide dismutase (Fe)sodBForwardTGGCGGTTCATGTCAAAGTA
ReverseACCAAAACCATCCTGAACCA
    Alkyl hydroperoxide reductaseahpCForwardAGTTGCCCTTCGTGGTTCGT
ReverseATCGCCCTTATTCCATCCTG
    CatalasekatAForwardACCGTTCATGCTAAGGGAAG
ReverseCCTACCAAGTCCCAGTTTCC
    Nonheme iron-containing ferritincftForwardTTCTTCTTCGTGTTGTTCGC
ReverseGCTGGAGCCTTCTTGTTTGC
    FerredoxinfdxAForwardCCCCACTTCTCATATCAGCG
ReverseATGCGTTGAATGCGTAGGAC
    RubrerythrinrbrForwardTGCAGCAGTTACTAGGTTTT
ReverseAGACATTTTAGAGAAGCGGC
    Ferric uptake regulatorfurForwardCCATTTCTTTTGGTTCAGCAG
ReverseTGCAATCAAGGCTTGCTGTC
    Carbon storage regulatorcsrAForwardTCAAAGTCGTTCAAACAGGG
ReverseTCATTCTGAACAACAGAATGC
General stress response genes
    Probable thiol peroxidasetpxForwardGCCAGTTACAATGGTGCTGA
ReverseTTTGCCACAAAATCACTTGC
    CochaperoningroESForwardAAACAACAGCCTCAGGCATAA
ReverseTTCTGTTCCACCGTATTTAGCA
    ChaperoningroELForwardGCAGGCGATGGAACAACTAC
ReverseTCCATACCGCGTTTTACCTC
    ChaperonednaKForwardCGGTATGCCACAAATCGAAG
ReverseGCTAAGTCCGCTTGAACCTG
    CochaperonednaJForwardTTTAAAAGGCGGTGGATTTG
ReverseTTTTCTACGACGCGATGATG
    Bacterioferritin comigratory protein homologBCPForwardACCCCAGGTTGTACTACAGAAG
ReverseAGCAATCTTACCTGTTTCATCG
    RelA/Spot family proteinspoTForwardGCCCCAATAGCCCATAGAC
ReverseACCCCAAGCAAATCAAGAAC
    Rod shape-determining proteinmreBForwardGAGCCTTCTGTTGTGGCAGTT
ReverseAGCGGATCATTTTTTCAGTCAT
    RND efflux system; membrane fusion proteincmeAForwardTATTACGCCGCTAACTTGAG
ReverseCAGCAAAGAAGAAGCACCAA
    RND efflux system; inner membrane transportercmeBForwardTAATCCAGGTATGGGAGGTA
ReverseGGAAAGATAGAAATGTAAGCG
    RND efflux system; outer membrane lipoproteincmeCForwardGGACGTTGAAGCAAGATGGT
ReverseAGTTGGCGCTGTAGGTGAAT
    Major outer membrane proteinporAForwardTTGATAGCGAACTTGATGAT
ReverseATACGAAGTCAGCACCAACG
    Inner membrane proteinyagUForwardCTATTTCCATACCCCACAGC
ReverseCCTTTAATTGCAGAAGTTCC
    ATP-dependent Clp protease ATP-binding subunitclpAForwardGTAGGAGCTGGAAGCACAGG
ReverseACGGCGACTTAGGGGTTTAT
Virulence factors and toxins
    Cytolethal distending toxin clustercdtAForwardTCCACATTTGTGCGTGATTG
ReverseGATTTGGCGATGCTAGAGTTT
cdtBForwardAAAGCATCATTTCCATTGCG
ReverseACCAAGAACAGCCACTCCAA
cdtCForwardCCAAAAGGAAGTTCATCAGC
ReverseAGCCTTTGCAACTCCTACTG
    Invasion antigen BciaBForwardCTCATCATTTGGAACGACTTG
ReverseAATTATACTCATGCGGTGGC
    Flagellin AflaAForwardCCAATGTCGGCTCTGATTTG
ReverseGCGCAGGAAGTGGATTTTC
    Flagellin BflaBForwardCCGTTTCCATCACCATCTTC
ReverseACACGCTTTGAAACAGGAGG
    Outer membrane fibronectin-binding proteincadFForwardTGCTTGTGGAGCTGGACGAG
ReverseTAAAAGCGGTGGATTTGGAC
    N-acetylneuraminic acid synthetaseneuBForwardTGTTGAAGTGGGACTAAGCG
ReverseTCTAACTTGCCATCGCCTAA
    Vacuolating cytotoxinsvacBForwardAAGGACGAGGTAGCATAGGT
ReverseCAAACGGCGATAGTGTTGAT
Housekeeping genes
    Gyrase subunit AgyrAForwardTGCTAAAGTGCGTGAAATCG
ReverseGCATTGGTGCGTTTTCCTAT
    Elongation factor TStsfForwardGAACTCCGCGAAAGTACAGG
ReverseTTGCCACAAAATCTGTTTCG
    16S rRNA16S rRNA geneForwardGCTCGTGTCGTGAGATGTTG
ReverseTCACCGTAGCATGGCTGAT
  • a RND, resistance nodulation cell division family.