Table 1.

Sequence of the primers used

PrimerSequencea (5′→3′)Site
A1GGGATCCAGAATTTAAAAGGAGGGATTAAAATGAAGAAAACAACAGCTTTTTTATTATGBamHI
A4AAGGCGCCTTAGTGGTGGTGGTGGTGGTGGTTGCTTGGAAGCTTACTTACCATNarI
C1GGGATCCAGAATTTAAAAGGAGGGATTAAAATGATCAAAGGTTCAAGCTTAAAGBamHI
C4AAGGCGCCTTAGTGGTGGTGGTGGTGGTGGTTAAGCAGTTTAACTTTTAGCTGAGCNarI
M1GGGATCCAGAATTTAAAAGGAGGGATTAAAATGAAAAGTAAATTGATAAAATTAAGTGCBamHI
M4AAGGCGCCTTAGTGGTGGTGGTGGTGGTGACCTAAGATAGCCTTCTTTAAAAGAGNarI
E1AGGATCCAGAATTTAAAAGGAGGGATTAAAATGAAAAAAAGGTTAGTGAAGABamHI
E4AAGGCGCCTTAGTGGTGGTGGTGGTGGTGCAGTGTGATTTTTCCTAACAAGNarI
F1GGGGATCCAGAATTTAAAAGGAGGGATTAAAATGAAGTAAGAATTTTAAAAGAGTAGGBamHI
F4CCCGGCGCCCTATTGGATAGAAAGAAGTGCTNarI
G1AGGATCCAGAATTTAAAAAGGAGGGATTAAAATGCTTAAGACTAAAAGAAAATTGACAABamHI
G4CCGGCGCCTTAGCCTTGAGGTAATTGGGNarI
FmatGGGGATCCAGAATTTAAAAGGAGGGATTAAAATGGCTTCAAGTCCTGCAAACAAGGTGTABamHI
sosdirACTATTGGTTGGAATGGCGTG
rSFACGATCCTGGTACACCTTGTTCGCGCCAGTACCTGCTGCAAAAGCTGT
fSFACAGCTTTTGCAGCAGGTACTGGCGCGAACAAGGTGTACCAGGATCGT
F3RACGTCAAGTATCCAGTGCATTC
48A1AGGATCCAGAATTTAAAAGGAGGGATTAAAATGTTAAAGATAAGTAAGAATTTTAAAAAAATAATGGBamHI
48A2AATAAAGTTGCAGCTGCTACAACTACAGCAAACAAGGTGTACCAGGATCG
48A3CGATCCTGGTACACCTTGTTTGCTGTAGTTGTAGCAGCTGCAACTTTATT
48A4AAGGCGCCCTATTTTGCAATTAATTTAGTAAGTTCCATAATATCTCNarI
cip1rAAGGATCCTTCGAACTACTCGAGTTCCTTTGTAGBamHI
FoxAAGGCGCCACGCGTTAAAAGGAGGGATTAAAATGAAAAAAGTATTATTGGCAANarI
RoxTTGGCGCCTTATTTAACTGTTATCTCACCCTCNarI
  • a Underlined sequences symbolize introduced restriction sites.