Table 2

Primer sequences used in this study for the construction and verification of correct allelic replacement in the L. rhamnosus GG knockout mutants

Primer nameSequence (5′–3′)aRestriction siteTarget region
Pro-1058ATGGATCCCCTATCGCAAGCGCCGCAATGGBamHI5′ HR1 spaCBA
Pro-1059ATCCCGGGCGTTTCACCACGACTTGTGTGGCSmaI3′ HR1 spaCBA
Pro-1389ATAAGCTTGCCACTTTTCGCTGCACCGTGACGHindIII5′ HR2 spaCBA
Pro-1390ATGAATTCCAGATGGGGCACGAATCGAGCTGGEcoRI3′ HR2 spaCBA
Pro-1050ATACTAGTGGTTCGACACTGCTGTTTCGTAAGSpeI5′ HR1 mbf
Pro-1051ATCCCGGGCGGGACAAAGATTGCCATCATGCCXmaI3′ HR1 mbf
Pro-1048ATGTCGACCTTTCCAGCGACGCCCGAATGSalI5′ HR2 mbf
Pro-1049ATGCGGCCGCGCTACCAGCCATAGCTTTCCTGNotI3′ HR2 mbf
Pro-1052ATCCCGGGGTGGCCGCGGCTGCTAAACTGCTGSmaI5′ HR1 adhA
Pro-1053ATACTAGTGCCAGCGCTTCTTGGCCTTGTACSpeI3′ HR1 adhA
Pro-1054ATGCGGCCGCGTTACGAGTATTGGCGCCAAGGCNotI5′ HR2 adhA
Pro-1055ATTCTAGACTGACTGGCTGTTGTTTTGCCGTCXbaI3′ HR2 adhA
Pro-1060ATCCCGGGGGGAACAAAGGTATCGGGCTGSmaI5′ HR1 spaD
Pro-1061ATACTAGTGCTGCCAAGAGACTGTGCCCGSpeI3′ HR1 spaD
Pro-1062ATGCGGCCGCGACAGGCGGAATCGGACTCTTCGNotI5′ HR2 spaD
Pro-1063ATTCTAGAGCTCTGCCAACCTGATACATACCCCXbaI3′ HR2 spaD
Pro-1733CGACGCTCTTGCTTGACTCAT_5′ spaCBA::TcR
Pro-1732CAGTTAAGCAATCAATCGTTACC_3′ spaCBA::TcR
Pro-1727CACGAAAGAGGGGCAAGAC_5′ inlJ::TcR
Pro-1728TAGATTTACTTTCATCCACTACTG_3′ inlJ::TcR
Pro-1730TACAGTCCATTCAACAAGCAGA_5′ adhA::TcR
Pro-1731CAACTTTAGGAATCAAATTAGCC_3′ adhA::TcR
Pro-1735CGTAACAGCCGACTTGTCC_5′ spaD::TcR
Pro-1734TTAGGGAGTCTGTTACTACTAC_3′ spaD::TcR
  • a Underlining indicates restriction recognition sites.