Table 3

Primers and probes used in this study for mRNA measurementsa

Target mRNAPrimer or probeSequence (5′-3′)Reference
PPIAFWCGCGTCTCCTTTGAGCTGTT_13
RVCTGACACATAAACCCTGGAAT AATTC_
TPCAGACAAGGTCCCAAAGACAGCAGAAAATTT_
IL-8FWTGGCAGCCTTCCTGATTTCT_2
RVTTAGCACTCCTTGGCAAAACTG_
TPCAGCTCTGTGTGAAGGT_
TNFFWTCTTCTCGAACCCCGAGTGA_10
RVCCTCTGATGGCACCACCAG_
TPTAGCCCATGTTGTAGCAAACCCTCAAGCT_
IL-10FWGTGATGCCCCAAGCTGAGA10
RVCACGGCCTTGCTCTTGTTTT
TPCCAAGACCCAGACATCAAGGCGCA
  • a FW, forward primer; RV, reverse primer; TP, TaqMan probe, dually labeled with 5′ 6-carboxyfluorescein and 3′ 6-carboxytetramethylrhodamine; PPIA, peptidyl-prolyl cis-trans isomerase A; IL-8, interleukin-8; IL-10, interleukin-10; TNF, tumor necrosis factor.