Table 2

Primers used in this studya

C. sakazakii serotypeTarget genePrimerSequence (5′-3′)Final concn (μM)Amplicon size (bp)
O1wzywl-35646CCCGCTTGTATGGATGTT0.10364
wl-35647CTTTGGGAGCGTTAGGTT0.10
O2wzywl-37256ATTGTTTGCGATGGTGAG0.06152
wl-37257AAAACAATCCAGCAGCAA0.06
O3wzywl-37258CTCTGTTACTCTCCATAGTGTTC0.10704
wl-37259GATTAGACCACCATAGCCA0.10
O4wzywl-39105ACTATGGTTTGGCTATACTCCT0.06890
wl-39106ATTCATATCCTGCGTGGC0.06
O5wzywl-39873GATGATTTTGTAAGCGGTCT0.10235
wl-39874ACCTACTGGCATAGAGGATAA0.10
O6wzywl-40041ATGGTGAAGGGAACGACT0.06424
wl-40042ATCCCCGTGCTATGAGAC0.06
O7wzxwl-40039CATTTCCAGATTATTACCTTTC0.06615
wl-40040ACACTGGCGATTCTACCC0.06
  • a Annealing temperature, 53°C.