Table 1

Real-time PCR primers and probes

AssayReported targetaLocusbPrimer and probe sequences (5′ to 3′)Reference(s)
Entero1Enterococcus spp.23S rRNAECST748F: AGAAATTCCAAACGAACTTG20, 35
ENC854R: CAGTGCTCTACCTCCATCATT
GPL813TQ: (6-FAM)TGGTTCTCTCCGAAATAGCTTTAGGGCTA(TAMRA)
uidAE. coliuidAF: CAACGAACTGAACTGGCAGA4
R: CATTACGCTGCGATGGAT
Probe: (6-FAM)CCCGCCGGGAATGGTGATTAC(TAMRA)
GenBac3Bacteroidales spp.16S rRNAGenBactF3: GGGGTTCTGAGAGGAAGGT7
GenBactR4: CCGTCATCCTTCACGCTACT
GenBactP2: (6-FAM)CAATATTCCTCACTGCTGCCTCCCGTA(TAMRA)
CperfClostridium spp.16S rRNAF: CATGCAAGTCGAGCGAKG28
R: TATGCGGTATTAATCTYCCTTT
Probe: (6-FAM)CCCACGTGTTACTCACCCGTCCG(TAMRA)
MultiplexIACUC1P1: (TET)CCTGCCGTCTCGTGCTCCTCA(TAMRA)13, 37
  • a Intended fecal microorganism source target.

  • b Assay's gene target.